1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timama [110]
4 years ago
12

Blood pressure can directly affect blood flow through the circulatory system.

Biology
1 answer:
postnew [5]4 years ago
6 0

True) Blood pressure does affect the blood flow through the circulatory system. Blood pressure is the pressure of circulating blood on the walls of blood vessels.


- R3KTFORGOOD ☕

You might be interested in
The diagram below shows the general structure of an amino acid. Which type of molecule is formed from amino acids?
andrey2020 [161]

Answer:

Proteins

Explanation:

Proteins are made up of many repeating units (monomers) of amino acids that are joined by peptide bonds.

Hope this helps :)

7 0
3 years ago
HI! PLEASE HELP ME ON THIS QUESTION!
Vilka [71]
I don’t know f I am correct but I think it’s C...
8 0
3 years ago
Read 2 more answers
What kind of cell is also called an epithelial cell
yan [13]
A skin cell, or any cell covering the surface of an organ are also known as epithelial cells.
5 0
3 years ago
Which best describes the main role of nucleic acids in living things?
Thepotemich [5.8K]

Answer:

idk here for the points

6 0
3 years ago
Which one of the following is a density-dependent limiting factor for a group of rattlesnakes?
borishaifa [10]

Answer:

... A disease resulting in the deaths of one third of a dense population of bats in a cave would be a

3 0
3 years ago
Other questions:
  • Which test is used to determine whether the substance being tested is likely to cause cancer in human?
    7·1 answer
  • During adolescence, the mass and girth of the bones increases. Which of these could be the appropriate justification for this?
    11·1 answer
  • 1 9.3.2 Quiz: Variation and Adaptation
    11·1 answer
  • In a active transport materials move from an area of ? Concentration and use ?
    12·2 answers
  • In what way do humans change<br> ecosystem? cite<br> example<br> some
    6·2 answers
  • What is convection heat
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is a gene? HELP PLEASE
    11·2 answers
  • If a man with type A blood has a child with a woman that is type B blood, can they have a child that is type O ?
    8·2 answers
  • Plant reproduction requires the presence of auxins, as well as a large amount of sugar for energy. Which two main plant tissues
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!