1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
4 years ago
14

What are the terms describes the dna–protein complexes that look like beads on a string?

Biology
1 answer:
marishachu [46]4 years ago
5 0

Answer: The question is incomplete,below is the complete question.

What are the terms describes the dna–protein complexes that look like beads on a string?

A) Chromatin

B) 30-nanometer fibre

C) Histones

D) Nucleosome

The correct answer is option D

Explanation: A Nucleosome is the basic fundamental unit of a DNA, and the fundamental sub-unit of a Chromatin.

The Nucleosome is the basic packing unit of DNA,it is built from histone proteins. A nucleosome is made up of 8 histones proteins resembling a thread wrapped round a spool.

The smallest bundle of DNA is known as a Nucleosome,a Nucleosome is produced through interaction between DNA and histone proteins.

You might be interested in
Put the following events in the order that they occur for a digital recording to become sound waves through a speaker
dlinn [17]

Answer:

1) sound is encoded on a digital recording as an electrical signal.

2) the digital recording plays the sound as an electrical signal.

3) the electric signal moves through a voice coil

4) The voice coil produces a magnetic field.

5) changing the magnetic field pushes and pulls on the diaphragm.

6 0
3 years ago
Which of the following best describes the fate of energy in ecosystems?
DanielleElmas [232]
<span>best describes the fate of energy in ecosystems </span>It flows through and is used by ecosystems.
4 0
4 years ago
Read 2 more answers
Which of the following describes the function of the endomembrane system
SVEN [57.7K]
Synthesis and transport of polypeptides.
6 0
4 years ago
Which range is the average resting pulse rate for adults?
Crank

Answer: 60 to 100 beats per minute.

Explanation:

Pulse is the number of times the hear pump blood out into the systemic circulation per minute

The lower this range the more efficient the heart is. In trained athletes the pulse rate is about 40bpm.

This shows the heart pumps blood at a faster rate to meet the demands of the muscles and other organs involved in the strenuous activities.

It can be measured by placing two fingers on the thumb side of the wrist,and count numbers of beats heard for 15 seconds.The counted number should multiplied by 4 to obtain beats per minute.

7 0
4 years ago
Which of the following units can be used to measure the mass of a grain of salt?
In-s [12.5K]
The unit that can measure salt is milligrams
5 0
3 years ago
Read 2 more answers
Other questions:
  • A forest in North America is rich in flower-bearing trees and coniferous trees. A forest fire damaged all these trees, but their
    11·1 answer
  • Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quick
    13·1 answer
  • Which of the following is true about the products formed during photosynthesis?
    6·2 answers
  • Hormones secreted into the environment are called _______________. A. pheromones B. perfumes C. stimulants D. attractants
    8·1 answer
  • What kind of problems will we face if our body had no muscles ​
    14·1 answer
  • A person who has allergies has a compromised immune system because the body's immune system
    13·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • You've been admitted to the hospital with a horrible illness. The doctor orders the nurse to give you IV fluids, then leaves the
    9·2 answers
  • JUST MOR DUM SCHOOL WRK
    12·2 answers
  • Cellular respiration “ adds or removes” carbon dioxide from the atmosphere
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!