1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
14

Part A - Name and describe the chemical process producers use to make glucose and the chemical process used by both consumers an

d producers to make ATP to contribute to the exchange.
Part B - Identify the products of each process and explain how these products are used in the exchange.

Biology
1 answer:
ANTONII [103]3 years ago
3 0

Answer:

The process that is used by producers to make glucose is called photosyntheis and the chemical process used by both producers ans consumers to make ATP ito contribute to the energy exchange is called cellular respiration.

Explanation:

Photosynthsis

Photosynthesis occue in the mesophyll tissue present in  leaves of plants .During photosynthesis the green plants or producers acquires CO2 from the atmosphere and utilizes water in presence of sunlight to produce glucose molecules along with the liberation of oxygen gas.

Cellular respiration

During cellular respiration the glucose molecules are oxidized to form energy in form of ATP along with the production of water and carbon dioxide.

    The O2 that formed during photosynthesis is inhaled by human beings for respiration whereas the CO2 that is produced as waste material inside our body is exhaled by us in the atmosphere.The CO2 is then used by the green plants to carry out photosynthesis.

You might be interested in
Why does salty food tend to dry your lips?
Mama L [17]
Because salt drags water out of everything
7 0
3 years ago
6. What is the role of chlorophyll and other pigments during photosynthesis?
Dahasolnce [82]

Answer the answer is c mu guy

8 0
2 years ago
Which of these is an environmental change that occurs rapidly?
lozanna [386]
Out of all the options, only "Volcanic Eruption" is the rapid change

In short, Your Answer would be Option D

Hope this helps!
8 0
3 years ago
Read 2 more answers
How do the reactant molecules become the molecules found in the products... what happens to them ​
Eduardwww [97]

Explanation:

Molecules of reactants and products undergoes chemical changes when they combine.

The combination leads to the breaking of bonds and rearrangement and this brings about the formation of new products.

  • Atoms in molecules tends towards stability
  • They often want to mimic the noble gases and would keep rearranging until stability is attained.
  • This leads to the formation of new compounds in the product end of the reaction.
5 0
3 years ago
In order for an atom to be considered "neutral", which of the following must be true?
Murrr4er [49]

Answer: C ) 'There are more protons than electrons'

4 0
2 years ago
Read 2 more answers
Other questions:
  • BRAINLIESTT ASAP!<br><br> Why do regions have different climates during the same seasons?
    7·2 answers
  • How do basophil cells react when a pathogen enters the body
    7·1 answer
  • Which of the following statements is/are true concerning peptide bonds? They are the only covalent bond formed between amino aci
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • After mitosis are the two new daughter cells diploid or haploid?
    12·2 answers
  • Understand the process of base pairing in both DNA and RNA.
    6·1 answer
  • __________ is the principle of dealing with environmental problems without discriminating against people based upon socioeconomi
    10·1 answer
  • Plss help me I need this :(​
    15·1 answer
  • which of the following lacks sufficient penetrating power for bulk sterilization? a. ultraviolet (uv) radiation at 260 nm.b. x r
    15·1 answer
  • Why do humans have a strong impact on the fast carbon cycle?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!