All categories

3 years ago

Skeletal muscles in which the fascicles form a common angle with the tendon are ________ muscles.

1 answer:

5 0

In some skeletal muscles, the fascicles form a common angle with the tendon. These skeletal muscles are known as Pennate muscles (also called pinnate muscles or penniform muscles). Generally, these types of muscles allow higher force production but smaller range of motion.

You might be interested in

In order for natural selection to take place we must have one individual. a cloned species. the same traits. variety in a popula

jeka57 [31]

In order for natural selection to take place we must have "variety in a population". This variety of traits is what allows natural selection to "pick" the most favorable traits.

8 0

3 years ago

Categorize each term as something that is typical of a scientific theory, a scientific hypothesis, or both.

Aleksandr-060686 [28]

Answer:

Explanation:

Scientific theory: a well established, highly reliable explanation

Scientific hypothesis: makes predictions of future events/

Both: based on observations of natural phenomenons/ can be tested by many researchers

5 0

2 years ago

Read 2 more answers

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

2 years ago

The ability to change color to avoid predators is a?

ZanzabumX [31]

It is called camouflage

5 0

3 years ago

Read 2 more answers

Some organisms are made of cells. TRUE or FALSE.

marusya05 [52]

<span>Yes, all living organisms are made of at least one cell (cell theory). But, remember, viruses and prions, which cause diseases, are not technically living things, and they are NOT made of cells. Also, if asked a question similar to this on a biology test, the teacher may be trying for an answer similar to: "Organisms are made of different organ systems, which are made of various related organs, which are made of different tissues working together, which are made of cells". </span>

4 0

2 years ago