Answer:
If a nation were to depend on foreign oil, if there were be an natural event to the country the nation is depending on that would cause a problem such as decreasement of oil or make it hard to export oil it would be hard to find an alternative efficiently. If there was to be a war or feud, or you eliminate an export to the country with the oil, they might stop sending oil.
Explanation:
Answer: A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item.
Explanation: google
Answer:
Faunal succession states that fossils in rock are placed in rock layers according to a chronological order
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation: