1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mafiozo [28]
3 years ago
11

Which is a broad of healthy people 2020

Health
2 answers:
soldier1979 [14.2K]3 years ago
7 0

Answer:

to increase the years of healthy life for each American

Explanation:

vladimir1956 [14]3 years ago
5 0
Healthy People 2020 is the federal government's prevention agenda for building a healthier nation. It is a statement of national health objectives designed to identify the most significant preventable threats to health and to establish national goals to reduce these threats.
You might be interested in
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
The Tabular List of Diseases and Injuries is most commonly referred to as the
inysia [295]

Answer:

The Tabular List of Diseases and Injuries is most commonly referred to as the International Statistical Classification of Diseases and Related Health Problems or ICD-10.

Explanation:

ICD-10 is an international classification system of diseases and injuries, proposed by the World Health Organization, and whose 10th edition is currently in use.

This numerical classification system is intended to statistically list everything related to diseases, their management, treatment and the mortality they produce, as well as temporal disability, return to work and automated decision making.

Additionally, ICD-10 is the statistical tool that simplifies the statistical management of diseases and their mortality worldwide.

8 0
3 years ago
Which helps in the production of eggs?
Drupady [299]

Answer:

C, semen

Explanation:

Smen because it fertilizes the egg to even grow

8 0
3 years ago
Read 2 more answers
The caregiver of a 6-year-old tells the clinic nurse that he is concerned that his 5-year-old child cannot yet print his first a
Dmitrij [34]
May be the nurse should say "don't lose hope as yet , we will see at the end of the term or year "
Something like that
4 0
3 years ago
Which of the following helps you overcome the speed differential that occurs when taking notes?
trapecia [35]

Answer:

a

Explanation:

Highlighting important

information

6 0
3 years ago
Other questions:
  • How does regular exercise improve cv fitness
    13·1 answer
  • Which of these words parts is a room that means “ pertaining to the brain”?
    12·2 answers
  • Imagine that you were required to work in the health and wellness industry for four years. What type of job or career would you
    10·1 answer
  • What will happen if the nervous system stops working in your body
    14·2 answers
  • Stretching is _____. is considered exercise some of the time, improves the health of your muscles, is mostly performed in the mi
    13·1 answer
  • Lead affects many species of animals. What kind of toxicity does it typically produce? A. acute B. acute and chronic C. periodic
    5·1 answer
  • Research: Should scientists be allowed to grow animals in artificial wombs?
    15·1 answer
  • The small particles around which water collects to form droplets are called _____.
    12·2 answers
  • Label The Female Reproductive System! Brainliest Give Away. Homework Help
    5·2 answers
  • AYO SOMEONE HELP ME ❗️❗️
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!