1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garri49 [273]
3 years ago
14

How do you use the periodic table to determine certain qualities of atoms?

Biology
1 answer:
Nikitich [7]3 years ago
4 0

Answer:

Determining Chemical Properties using the Periodic Table. Chemical properties of each element are determined by the element's electronic configuration, and particularly by its outermost valence electrons.

You might be interested in
Which of these is most likely to occur when biodiversity is lost in an ecosystem?
Blababa [14]
Post full question not half
Then i ll able to help yu
Please
3 0
3 years ago
Read 2 more answers
What will be the most likely result for some species of animals with the continued burning of rain forests in africa?
charle [14.2K]
The answer is a. soil erosion 
5 0
4 years ago
a bar of gold has a temperature of 27 and a bar of aluminum has a temperature of 22. Which statement best explains why the bar o
Svetach [21]

Answer:

The Particles that make up the aluminum bar are moving slowly.

Explanation:

Hope this helps.

3 0
4 years ago
Read 2 more answers
System of layout refers to the design of planting trees <br><br>true or false​
ohaa [14]

\:  \:

<h2><u>TRUE</u></h2>

  • <u>system of layout refers to the designs of planting trees.it is desirable planted in a systemic way</u>

<h2><u>hope</u><u> it</u><u> helps</u></h2>
7 0
2 years ago
A student makes the claim that the space around a charged particle will exert a force on any other charged particle that is plac
aleksley [76]

Answer:

An object with a negative charge will move toward the positive plate.

Explanation:

Because it is negative, it would prefer to go to the positive plate.

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which is NOT true of eukaryotic cells?
    9·1 answer
  • Which conditions lead to a slower rate of weathering? Check all that apply.
    9·2 answers
  • A bone marrow transplant includes several steps. Order these steps for a successful transplant to cure leukemia.
    5·1 answer
  • Which of the following represents a difference between eccrine sweat glands and apocrine sweat glands? Eccrine sweat glands are
    8·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Peridotite, which is composed almost entirely of dark silicate minerals and is believed to make up much of Earth’s upper mantle,
    7·1 answer
  • In humans, the process of digestion begins in the _____________ where food is ________________ into small pieces by the teeth. T
    6·1 answer
  • Example of irritability in animals​
    8·2 answers
  • Biochemists developed a compound that they hypothesize will disrupt the ability of the cells to organize centrioles and microtub
    11·1 answer
  • Don't copy and paste from other question answers plss. I'm giving 40 points
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!