1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
2 years ago
5

The combustion of 0.570 g of benzoic acid (ΔHcomb = 3,228 kJ/mol; MW = 122.12 g/mol) in a bomb calorimeter increased the tempera

ture of the calorimeter by 2.053naughtC. The chamber was then emptied and recharged with 2.900 g of glucose (MW = 180.16 g/mol) and excess oxygen. How much did the temperature change from the combustion of the glucose? ΔHcomb for glucose is 2,780 kJ/mol.
Chemistry
1 answer:
torisob [31]2 years ago
6 0

Answer:

The temperature change from the combustion of the glucose is 6.097°C.

Explanation:

Benzoic acid;

Enthaply of combustion of benzoic acid = 3,228 kJ/mol

Mass of benzoic acid = 0.570 g

Moles of benzoic acid = \frac{0.570 g}{122.12 g/mol}=0.004667 mol

Energy released by 0.004667 moles of benzoic acid on combustion:

Q=3,228 kJ/mol \times 0.004667 mol=15.0668 kJ=15,066.8 J

Heat capacity of the calorimeter = C

Change in temperature of the calorimeter = ΔT = 2.053°C

Q=C\times \Delta T

15,066.8 J=C\times 2.053^oC

C=7,338.92 J/^oC

Glucose:

Enthaply of combustion of glucose= 2,780 kJ/mol.

Mass of glucose=2.900 g

Moles of glucose = \frac{2.900 g}{180.16 g/mol}=0.016097 mol

Energy released by the 0.016097 moles of calorimeter  combustion:

Q'=2,780 kJ/mol \times 0.016097 mol=44.7491 kJ=44,749.1 J

Heat capacity of the calorimeter = C (calculated above)

Change in temperature of the calorimeter on combustion of glucose = ΔT'

Q'=C\times \Delta T'

44,749.1 J=7,338.92 J/^oC\times \Delta T'

\Delta T'=6.097^oC

The temperature change from the combustion of the glucose is 6.097°C.

You might be interested in
1
Effectus [21]

Answer:

There are 5! goodluck,

Explanation:

4 0
1 year ago
Could anyone help me with question 3?
Masteriza [31]
What your question for number 3
8 0
2 years ago
What is the percent by mass of oxygen in mg(oh)2
kakasveta [241]

54.868% because well la la la (sorry had to be 20 characters)

3 0
3 years ago
7. Disulfur dichloride can be made by reacting chlorine gas with molten sulfur. What is the yield of S2Cl2 expected in a laborat
Pie

Answer:

11.4g of S₂Cl₂ is the expected yield

9.69g of S₂Cl₂ are produced with a 85% yield

Explanation:

The reaction of sulfur S₈ with Cl₂ to produce S₂Cl₂ is:

S₈ + 4Cl₂ → 4S₂Cl₂

<em>Where 1 mole of sulfur reacts with four moles of chlorine to produce four moles of disulfur dichloride.</em>

To find the limiting reactant you need to convert mass of each reactant to moles using its molar mass, thus:

S₈ (Molar mass: 256.52g/mol): 10.0g ₓ (1mol / 256.52g) = 0.0390 moles S₈

Cl₂ (Molar mass: 70.9g/mol): 6.00g ₓ (1mol / 70.9g) = 0.0846 moles Cl₂

For a complete reaction of 0.0390 moles of sulfur, there are necessaries:

0.0390 mol S₈ ₓ (4 mol Cl₂ / 1 mol S₈) = <em>0.156 moles Cl₂. </em>As you have just 0.0846 moles of chlorine, Cl₂ is the limiting reactant.

As 4 moles of Cl₂ produce 4 moles of S₂Cl₂.<em> 0.0846 moles of Cl₂ produce, in theory, 0.0846 moles of S₂Cl₂ (Molar mass: 135.04g/mol). </em>In mass:

0.0846 moles S₂Cl₂ ₓ (135.04g/mol) =

<h3>11.4g of S₂Cl₂ is the expected yield</h3>

If you produce just the 85.0% of yield, mass of S₂Cl₂ is:

11.4g ₓ 85% =

<h3>9.69g of S₂Cl₂</h3>
3 0
3 years ago
This picture shows students working in a
Lilit [14]

Answer:

yes it is true they apply necessary safety measures

8 0
3 years ago
Other questions:
  • recommend an element use to fill bottles that contain ancient paper. the element should be a gas at room temperature, should be
    12·1 answer
  • Lewis dot structure for N3-
    12·2 answers
  • Work and energy have the same unit why​
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following elements has chemical properties similar to selenium? Which of the following elements has chemical proper
    8·1 answer
  • What are sports examples that involve transfer of momentum
    5·2 answers
  • 3. Match each of the following descriptions with one of the beakers in Model 1. In each case, assume the change in volume as the
    11·1 answer
  • HELP ME!!! What is the gravitational potential energy of a 200 Kg wrecking ball that is held up 25 m off the ground?
    14·1 answer
  • Which chemical or physical change is a endothermic process
    5·2 answers
  • ASPA!!!! How could a scientist determine what elements are present in a distant star by looking at its absorption spectrum?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!