1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
14

Beth’s mothers uses cloth bags to carry her groceries home from the grocery store. How does using cloth bags instead of paper ba

gs help the environment?
A) there is more trash


B) more trees are cut down

C) fewer trees are cut down


D) more paper bags are made
Biology
1 answer:
dexar [7]3 years ago
3 0

Answer:

C)fewer trees are cut down

Explanation:

The cloth is not made of trees while the paper bags are

You might be interested in
As many as _____ percent of cases of erectile disorder are caused by medical conditions such as cardiovascular disease, multiple
pshichka [43]
35 percent of cases of erectile
4 0
3 years ago
The Go' for the reaction Citrate  Isocitrate is +6.64 kJmol-1 . The Go' for the reaction Isocitrate  α-Ketoglutarate is -267
xz_007 [3.2K]

Answer:

ΔG°' for the conversion of citrate to α-ketoglutarate = - 273.64  kJmol-1

Explanation:

ΔG°' for Citrate is +6.64 kJmol-1

ΔG°' for Isocitrate is -267 kJmol-1

ΔG°' for the conversion of citrate to α-ketoglutarate = ΔG°' for product - ΔG°' for reactant

ΔG°' for the conversion of citrate to α-ketoglutarate = -267 kJmol-1 - (+6.64 kJmol-1)

ΔG°' for the conversion of citrate to α-ketoglutarate = - 273.64  kJmol-1

7 0
3 years ago
The diagram shows a normal red blood cell and a shrunken red blood cell, both of which are in salt water.
bixtya [17]

Answer: Water moved from inside the red blood cell into the salt water.

This is because of the osmotic difference between the salt solution and the red blood cell. This means that there is difference in the solute (salt) concentration inside the red blood cell and the salt solution.

Explanation: The salt concentration in the solution is higher than the salt concentration inside the red blood cell, that is, the red blood cell has more water concentration that the salt solution, therefore there will be movement of water from the inside of the red blood cell into the salt solution thereby causing the red blood cell to reduce in size. The movement of water from the red blood cell into the salt solution is to create a balance between the water concentration in the two environments, hence the movement of water from an area of high water concentration to an area of low solvent concentration across the selectively permeable membrane of the red blood cell.

5 0
3 years ago
Read 2 more answers
Gene mutations can best be described as changes in the
Sergio039 [100]
I’m guessing in the chromosomes
6 0
3 years ago
In which cellular structure are the enzymes of the calvin cycle localized?
ratelena [41]
The stroma

The enzymes in the Calvin cycle are found in the stroma instead of the cell cytosol, separating the reactions.
3 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What is a single-celled organism called?
    5·2 answers
  • Is it true that the breakdown of food molecules in the gut does not require coupling of atp hydrolysis, but enzymes are required
    10·1 answer
  • The effect of cell size on material transport
    15·1 answer
  • What is the smallest working unit of living things?
    13·1 answer
  • Eric follows a vegetarian eating pattern, and he wants to know whether he needs to take any vitamin and mineral supplements. wha
    11·1 answer
  • What is the monomer and polymer of carbs?
    13·1 answer
  • What is a plant nucleus
    6·1 answer
  • Bacillus cereus is naturally found in the soil. B. cereus is known to contaminate rice, which, if undercooked and ingested, can
    8·1 answer
  • what would happen if the cell membrane was made out of a water-soluble molecule instead of the water-hating lipid.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!