Weather is an example of rapid environmental changes.
Explanation:
Environment refers to our natural world surroundings. Rapid means fast or quick. Weather around us keeps changing as the earth rotates and revolves around the sun. It changes depending on the month of the year or may change from day to night. You can also note the room temperature at different times in a day, it keeps changing mostly minorly but it does change. There are sunny, foggy, rainy, cold etc days and hence we can say that weather is example of rapid environmental changes.
Answer:
a. PGA down, RuBP up
Explanation:
RuBP, also known as Ribulose-1,5-bisphosphate is a molecule that assist in he fixation of carbon dioxide in the Calvin Cycle or light independent reaction of photosynthesis.
RuBP is combined with carbon dioxide using the enzyme known as rubisco to form an short-lived intermediate product which divides to form two 3-carbon molecule structure known as 3-phosphoglycerate.
<em>If the concentration of carbon dioxide is suddenly reduced, it thus means that the rate of production of 3-phosphoglycerate will reduce as carbon dioxide becomes a limiting factor. Hence, 3-phosphoglycerate's concentration will reduce while more RuBP will become available as a result.</em>
The correct option is a.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
True
Explanation:
Physical contamination are foreign objects such as hair, fingernails, broken glasses , jewelries etc that are mixed with food. Although, it is important for a food handler who realizes that he is sick such as having fever, jaundice,wound while working to report such to his supervisor or manager,who will then take necessary action and to avoid risk of contamination; yet not the only cause of physical food contamination.
Physical contamination does not necessarily have to occur until the food handler is sick. It could be as a result of carelessness or not paying attention enough by the food handler . Physical contamination might not at all times cause injury or illness to the customer, yet such could bring discomfort to a customer who notices foreign objects in his food while eating. To avoid risk of physical food contamination, it is important for food handlers to keep jewelries to a minimum, wash fruits and vegetables thoroughly, wear hear neatly tied back, throw out and replace cracked, chipped, or broken dishware, glassware and equipment amongst others.
