1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
3 years ago
15

An organism's reproductive cells, such as sperm or egg cells, are called

Biology
1 answer:
Annette [7]3 years ago
8 0
Their called a gametes
You might be interested in
Help plz asap asap plz
weeeeeb [17]

Answer:cholem im pretty surw

Explanation:

5 0
2 years ago
How does fever indicate that your body immune system it's doing its job?
photoshop1234 [79]
Ur body heats up to kill the bacteria in ur body
7 0
3 years ago
The __________ lobe contains the primary sensory cortex, which controls sensations such as touch or pressure
Mama L [17]
The parietal lobe contains the primary sensory cortex, which controls sensations such as touch or pressure.
7 0
3 years ago
Throw some loght on dichloroindophenol chemical and its function in photosynthesis
madam [21]

Answer:

Dichloroindophenol chemical act as electron acceptor in photosynthesis

Explanation:

DCPIP (2,6-dichlorophenol-indophenol) in general is a dye of blue color which reduces to become colorless and hence act as an electron acceptor in the light reactions of photosynthesis

It is used to measure the rate of photosynthesis, because its reduction leads to identification of reducing agent (Diphenylcarbazide) in plant  that is produced at the time of photosynthesis with in the chloroplasts.

8 0
3 years ago
What function do proteins perform in the cell membrane
r-ruslan [8.4K]

Answer:

Membrane proteins perform a variety of functions vital to the survival of organisms: Membrane receptor proteins relay signals between the cell's internal and external environments. Transport proteins move molecules and ions across the membrane.

Explanation:

they help transport some substances through the membrane.

4 0
3 years ago
Other questions:
  • Oysters and barnacles are in competition for space on a rock. Which of the following best describes this relationship?
    6·2 answers
  • The LEAST LIKELY reason for Cubans to migrate mostly to Miami since the 1960s was the A) American dream. B) better climate. C) p
    9·2 answers
  • What part of the brain controls certain reflexes and coordinates the body's movements?
    8·1 answer
  • dependent variable: the changes that are measured in an experiment. Written after the then _____ in the hypothesis​
    14·1 answer
  • Most life forms cannot use N2 as it exists in the atmosphere. ___________ are able to convert N2 to reactive nitrogen, which can
    5·1 answer
  • How is blood pressure measured?
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Developing countries tend to have high birth rates. why?
    8·1 answer
  • Changes in state of matter
    7·1 answer
  • Which statement is true of the many parts if the biosphere
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!