Mutations in DNA include deletions and insertions. These types of mutations:

Biology

1 answer:

pantera1 [17]2 years ago

6 0

Answer:

(A). Result in different amino acids to be read due to frame shifts

Explanation:

Insertion or deletion mutations (or Indel mutations) can be defined as mutations in DNA due to insertion (addition) or deletion of nucleotide bases in DNA.

These mutations lead to change in reading frames (sequence of codons), which leads to formation of protein having completely different amino acid sequence. Hence, these mutations are also cause frameshift mutations.

This is due due to triplet nature of genetic codes as insertion or deletion of one or more bases (but not three) would change change in codon sequence and mutated sequence can form a non-functional or truncated protein.

Thus, the correct answer is option (A).

You might be interested in

which is needed for one nerve to communicate with another nerve across a synapse? electrical signals nodes of ranvier neurotrans

never [62]

Our interconnected neurons help us process different types of information. Synapses are the gaps between neurons. <span>When an impulse reaches the end of one axon, it is now an action potential. This electric signal cannot leap across this gap so as to speak. Special chemicals called neurotransmitters have this role to be possible. The best answer is thus neurotransmitters. </span>

3 0

3 years ago

During the late cretaceous, the bisti badlands were home to numerous animals including turtles, crocodiles, and even dinosaurs.

vaieri [72.5K]

These animals were living in an environment with a warm climate that results in changing sea levels. These conditions create a lot of shallow inland seas allowing these animals to thrive. The Cretaceous period is the last period of the Mesozoic area where new groups of mammals, birds, and flowering plants appeared on Earth.

7 0

3 years ago

Drag the labels onto the flowchart to identify the sequence in which carbon moves through these organisms. resethelp carbon ente

gladu [14]

Answer:

treatment, treatment, control

Indep. Var.

Dep. Var.

Dep. Var

3 0

3 years ago

Read 2 more answers

Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU

coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0

3 years ago

Aldosterone stimulates an increase in sodium reabsorption at the same time it stimulates an increase in potassium secretion. ald

Katarina [22]

A. True
Aldosterone stimulates the Na+/K+ pump in renal tubules to exchange Na+ (sodium) for K+ (potassium). This, using ATP energy for active transport, leads to reabsorption of sodium into the bloodstream and secretion of potassium into the urine.

7 0

3 years ago