1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gladu [14]
2 years ago
12

Mutations in DNA include deletions and insertions. These types of mutations:

Biology
1 answer:
pantera1 [17]2 years ago
6 0

Answer:

(A). Result in different amino acids to be read due to frame shifts

Explanation:

Insertion or deletion mutations (or Indel mutations) can be defined as mutations in DNA due to insertion (addition) or deletion of nucleotide bases in DNA.  

These mutations lead to change in reading frames (sequence of codons), which leads to formation of protein having completely different amino acid sequence. Hence, these mutations are also cause frameshift mutations.

This is due due to triplet nature of genetic codes as insertion or deletion of one or more bases (but not three) would change change in codon sequence and mutated sequence can form a non-functional or truncated protein.

Thus, the correct answer is option (A).

You might be interested in
which is needed for one nerve to communicate with another nerve across a synapse? electrical signals nodes of ranvier neurotrans
never [62]
Our interconnected neurons help us process different types of information. Synapses are the gaps between neurons. <span>When an impulse reaches the end of one axon, it is now an action potential. This electric signal cannot leap across this gap so as to speak. Special chemicals called neurotransmitters have this role to be possible. The best answer is thus neurotransmitters. </span>
3 0
3 years ago
During the late cretaceous, the bisti badlands were home to numerous animals including turtles, crocodiles, and even dinosaurs.
vaieri [72.5K]
These animals were living in an environment with a warm climate that results in changing sea levels. These conditions create a lot of shallow inland seas allowing these animals to thrive. The Cretaceous period is the last period of the Mesozoic area where new groups of mammals, birds, and flowering plants appeared on Earth.
7 0
3 years ago
Drag the labels onto the flowchart to identify the sequence in which carbon moves through these organisms. resethelp carbon ente
gladu [14]

Answer:

treatment, treatment, control

Indep. Var.

Dep. Var.

Dep. Var

3 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Aldosterone stimulates an increase in sodium reabsorption at the same time it stimulates an increase in potassium secretion. ald
Katarina [22]
A. True
Aldosterone stimulates the Na+/K+ pump in renal tubules to exchange Na+ (sodium) for K+ (potassium). This, using ATP energy for active transport, leads to reabsorption of sodium into the bloodstream and secretion of potassium into the urine.
7 0
3 years ago
Other questions:
  • What’s the monomers of nucleic Acids ?
    12·1 answer
  • What's is the honey badgers greatest asset or quality?
    7·2 answers
  • Contrast the reproduction of bacteria with that of frogs
    12·1 answer
  • Please answer these questions.
    7·1 answer
  • Cars entering our field of vision from the side require the use of _______. A. peripheral vision B. central vision C. both perip
    11·1 answer
  • What is the definition for Allele?
    13·2 answers
  • Can someone help me please and thank you!!
    11·1 answer
  • Help i’m being timed
    9·1 answer
  • Which phylum of fungi contains the bracket-type of fungi that is found on the sides of trees?
    9·1 answer
  • The distribution of wild horses would be classified as
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!