1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nasty-shy [4]
3 years ago
11

The area at the back of the left temporal lobe that is crucial in the ability to listen, process, and understand what others are

saying is ________ area.
Biology
1 answer:
swat323 years ago
4 0

Answer: The auditory cortex

Explanation:

The temporal lobe is primarily involved auditory perception which includes hearing, processing and understanding. The temporal lobe houses the primary auditory cortex.

The primary auditory cortex collects sensory information from the ears and other secondary areas, it processes the information into meaningful terms such as speech and words.

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How does the skeletal system of an embryo differ from that of an adult?
Cloud [144]
Almost the entire system of an embryo is made of cartilage, whereas that of an adult is mostly made of bones.
8 0
3 years ago
FOR CONSTRUCTED RESPONSE QUESTION!
Vlad1618 [11]

The two stages of photosynthesis: Photosynthesis takes place in two stages: light-dependent reactions and the Calvin cycle (light-independent reactions). Light-dependent reactions, which take place in the thylakoid membrane, use light energy to make ATP and NADPH.

4 0
3 years ago
The number of chromosomes in the cells made by meiosis are?
Alexus [3.1K]

Answer: 46 chromosomes

Explanation: Germ cells contain a complete set of 46 chromosomes (23 maternal chromosomes and 23 paternal chromosomes). By the end of meiosis, the resulting reproductive cells, or gametes, each have 23 genetically unique chromosomes. The overall process of meiosis produces four daughter cells from one single parent cell.

3 0
3 years ago
Many sources of water pollution are found within the home. What actions can you take to reduce water pollution.
ra1l [238]

Answer:

Avoid putting oils in water, and don't put trash in it either.

3 0
3 years ago
Other questions:
  • The Earth is about 4.6 billion years old. However, the oldest sea floor is only about 180 million years old. What do you think i
    10·1 answer
  • Which phase of meiosis occurs right after crossing over takes place
    6·2 answers
  • Chemotaxis is a process by which bacteria select one:
    6·1 answer
  • Which two factors often determine the type of rock that is formed by a
    9·2 answers
  • CHECKPOTS<br> What is one method for controlling amebic dysentery?
    10·1 answer
  • You are maintaining a small population of fruit flies in the laboratory by transferring the flies to a new culture bottle after
    9·1 answer
  • Which of the following is a major contributor to soil erosion? Agriculture, Urban development, invasive species, deforestation
    15·2 answers
  • 2. What is a feature of transcription? * 1 point Both strands of a DNA molecule act as a template for mRNA. Nucleoside triphosph
    13·1 answer
  • Inattention is generally caused by concentration on __________.
    7·1 answer
  • Question 2 of 10<br> Which sustainable building practice does the photograph show?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!