1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
11

At a hypothetical locus, a man’s genotype is Aa. What proportion of his gametes would be expectedto receive the A allele?a.1/3b.

1/2c.3/4d.1/4e.1/8
Biology
1 answer:
nydimaria [60]3 years ago
7 0

Answer: The correct answer is 1/2

Explanation:

Based on Mendel's 2nd law - the law of independent assortment of genes - each character behaves as a separate unit and is INHERITED independently of any other character.

So, Aa will separate in two alleles "A" and "a". And by the law, each will be received by the gametes in equal rate of 50:50 i.e 1/2.

So for"A" allele, it is 1/2

You might be interested in
What can happen to the people who do not provide care for someone with alcohol poisoning, and that person dies?
Drupady [299]
They will go to jail
7 0
3 years ago
An increase in the biodiversity of an ecosystem leads to an increase in its productivity.
Liono4ka [1.6K]

Answer: Your answer is True.

Explanation:

8 0
3 years ago
Which of the following is NOT a
Lostsunrise [7]
D. Applying fertilizer granules to your yard
3 0
3 years ago
Read 2 more answers
Which one of the following is an example of epithelial tissue?
Kruka [31]
B. subcutaneous skin layer

6 0
3 years ago
A landslide has isolated a part of the cicada population from the main population. After a few generations, the new generations
umka2103 [35]
<span>The bottleneck effect is the cause of the sudden shift in the genetic information of the population. Due to the landslide, suddenly high number of the members of the main population died, and this caused genetic drift for reducing the variation in the existing generation, which is now widely different from the original one.</span><span />
7 0
3 years ago
Other questions:
  • Where did the following drugs originate from?
    5·1 answer
  • After age ______ or so, total kilocalorie needs of physically inactive adults fall steadily throughout adulthood.
    13·1 answer
  • ¿¿cuales son los materiales iniciales de la glucolisis??
    13·1 answer
  • Compare group selection to single-tree selection.
    8·2 answers
  • Sharks an dolphins look very similar so are they related
    5·1 answer
  • How can islands be created by plate tectonics
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What are the three parts of the cell theory
    12·2 answers
  • What are 2 characteristics of s waves
    7·1 answer
  • What does the Miller-Urey experiment tell us about the origin of life?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!