1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
3 years ago
7

Angiosperms _____. have flowers have cones are nonvascular are seedless

Biology
1 answer:
Tresset [83]3 years ago
3 0


Angiosperms have flowers.

Angiosperms are plants which produce flowers and are thus commonly referred to as the flowering plants.

All angiosperms  produce flowers at some stage in their life. Flowers are important to the angiosperms  because they serve as the reproductive organ for the plant, providing a means for the plant to propagate itself. 

Angiosperms are the largest group of plants on earth. They account for approximately 80% of all known living plants. There are about 270,000 known species of angiosperms that live on the earth today.




You might be interested in
Giraffes evolved over many generations to have long necks. Giraffes that had longer necks were more likely to survive than giraf
Leokris [45]
Hello. Giraffes with longer necks survive compared to those with shorter necks because of natural selection. Over time, natural selection favors the traits that would make a species thrive better in the environment. Giraffes with short necks won't have access to that much food compared to those with long necks thus they eventually died out.

ANSWER: natural selection.
6 0
3 years ago
Read 2 more answers
¿Qué es homeostasis?
Marina CMI [18]

La tendencia hacia un equilibrio relativamente estable entre elementos interdependientes, especialmente cuando se mantiene mediante procesos fisiológicos.


if this is wrong sorry i had to use google translate

7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which organisms can conduct photosynthesis?
bezimeni [28]
The answer is a. Plants, algae, and certain Protista
3 0
3 years ago
Read 2 more answers
If a woman has had a intercourse, and she missed a menstrual period by more than 14 days, she probably is pregnant. True or Fals
-BARSIC- [3]

Answer:

true

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • How are plant pigments like teammates on a sports team?
    11·2 answers
  • During a quiet eruption, a lava flow may set fire to and then bury everything in its path. true or false?
    11·1 answer
  • Which statement describes an important role of carbon dioxide in Earth's atmosphere?
    15·1 answer
  • Is this statement True or False?
    10·1 answer
  • What are the main structures and functions of the musculoskeletal system? What are the main structures and functions of the inte
    11·2 answers
  • Which two structures of plants and fungi preform similar functions?
    12·2 answers
  • Please help with this question, thank you. ​
    8·1 answer
  • Most earthquakes happen along the ?
    14·1 answer
  • How is density affected when the salinity increases?
    7·2 answers
  • This demand curve has shifted. The original demand curve is labeled as D. The new demand curve is labeled as D1.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!