1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
11

Which of the following adaptations is most likely not found in organisms of the savanna?

Biology
2 answers:
mariarad [96]3 years ago
8 0

Answer: Thick fur

Explanation:

Savanna is a place which has a high temperature. The animals that reside at such temperature needs no fur because the temperature there is warm and hot.

The animals there have long legs so that they can easily walk in the grasses and eat it.

They have the capability to graze and they make burrows to stay cool inside their burrow.

The animals there eats tress and grasses which are long.

Firlakuza [10]3 years ago
5 0

Answer;

Animals with thick fur

Explanation;

-It is worth noting that organisms that live in the savanna and grassland biomes have developed unique adaptations that aid in their survival. Savannas differs from grassland in that savanna have shrubs and isolated trees, while grasslands contain grasses, flowers, and herbs.

-Animal adaptations for example; Many animals have very effective locomotion for long-distance migrations to coincide with the seasonal flush of growth.

-Additionally, many forms burrow to avoid predation and desiccation, and many others use these burrows. These and other characteristics aid survival of organisms in savanna ecosystem.

You might be interested in
What do we call the speed needed for a projectile (like a cannonball) to overcome the force of Earth's gravity?
Ymorist [56]
Newton’s cannonball
7 0
3 years ago
Read 2 more answers
what would happen to an enzyme if the temperature and pH changed significantly beyond the enzyme`s optimum level?
allochka39001 [22]
<span>If the PH and temperature changed significantly beyond the enzyme optimum level it will become denatured and then the enzyme would not work.
The Enzyme is a biological catalyst which speeds up a reaction. The Enzyme has molecules which act upon as substrates and then it converts those substrates into different molecules which are called products.
The study of the enzyme is known as enzymology, and they are well known to catalyze more than 5,000 biochemical reaction types.</span>
6 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
What a water pollution<br> plz hurry
Jet001 [13]

Answer:

pollution of water. or do you mean pollutant in which case would be like garbage or oil spills

6 0
2 years ago
Read 2 more answers
PLEASE HELP ME WITH THIS PROBLEMMMMM T^T ~
solmaris [256]
2.88 per month is 32.88 per month in other words 32,88 dollars
6 0
2 years ago
Other questions:
  • Which statement describes the formation of galaxies?
    14·2 answers
  • How are osmosis and diffusion alike
    11·1 answer
  • A large explosion that takes place at the end of a star’s life cycle is called a ____________.
    8·2 answers
  • Water vapor in the atmosphere is important for which of the following reasons?
    10·1 answer
  • Which statement is a hypothesis? Jada decides to investigate the effectiveness of hand sanitizers compared to soap. She says tha
    15·2 answers
  • A mutation that results in a single amino acid substitution in the active site of an enzyme
    10·1 answer
  • In 1859, a small colony of 24 rabbits was brought to Australia. By 1928 it was estimated that there were 500 million rabbits in
    12·1 answer
  • Which of the following resources is renewable?
    12·2 answers
  • Why is sustainability a problem in agriculture crops ?
    12·2 answers
  • What is the relationship between the ETC and oxygen?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!