1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
4 years ago
12

PLEASE PLEASE PLEASE HELP HURRYYYY

Biology
2 answers:
miv72 [106K]4 years ago
6 0
The leaves of the plant compared to the plants around it are bigger because they are being token care of and watered and fed while the others take care of them selves also they are different types of plants :)
motikmotik4 years ago
4 0

dear friend, make it into sentence I will share my opinions to it in point wise:

1) Rate of photosynthesis will be high

2) water loss is very high

3) blocks the sunlight

4)competes for water.. broad would more

You might be interested in
Igneous rocks were the first rock type to appear on Earth true or false
KATRIN_1 [288]
Igneous rocks were the first type of rock to appear on earth, so it is true
4 0
3 years ago
People who have land near the preserve think that their land will
Vinvika [58]
In theory they believe it would Increase I assume
6 0
3 years ago
Explain the mechanism of nematocyst in Portuguese man of war?
Katyanochek1 [597]

Answer:

Scientists believe that man-of-wars spawn together in large numbers, with each colony (being either all male polyps or all female polyps) releasing gametes into the water to be fertilized. The resultant larvae then each go through asexual budding to produce a new man-of-war colony.

7 0
3 years ago
O
noname [10]
C, frameshift mutation

Have a great day!
7 0
3 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Other questions:
  • Differences between bryophytes and pteridophytes​
    8·1 answer
  • Encoding failure is likely due to
    5·1 answer
  • After a person recovers from the chickenpox the virus can lie dormant in the dorsal root ganglion in multiple levels of the spin
    14·1 answer
  • What is 80% of the world made of?
    13·2 answers
  • Which of the following is an example of genomic imprinting in humans? Which of the following is an example of genomic imprinting
    14·1 answer
  • What different gland and hormones are involved in the production of amino acids
    8·1 answer
  • Complete the T-chart by categorizing each statement as something that would most likely be relevant to gene flow or genetic drif
    16·2 answers
  • Everything including you and me is made up of matter<br> True or False
    9·2 answers
  • Why do plants contain the<br> greatest amount of energy in the<br> food pyramid?
    11·1 answer
  • Which gestational period is dominated by the development of organs and organ systems?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!