Igneous rocks were the first type of rock to appear on earth, so it is true
In theory they believe it would Increase I assume
Answer:
Scientists believe that man-of-wars spawn together in large numbers, with each colony (being either all male polyps or all female polyps) releasing gametes into the water to be fertilized. The resultant larvae then each go through asexual budding to produce a new man-of-war colony.
C, frameshift mutation
Have a great day!
Answer:
CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA
Explanation:
Cytosine pairs with Guanine.
Adenine pairs with Thymine.
