1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
3 years ago
8

What created galapagos

Biology
1 answer:
LUCKY_DIMON [66]3 years ago
4 0

The Galápagos Islands were formed as a result of several of Earth's internal processes.

You might be interested in
Which organelle fills the cell, holds organelles, and is the place for most of the metabolic activity in the cell occur?
Andru [333]

A. Cytoplasm


(The Nucleus is the control, site of DNA)

Cell wall is in plant cells, giving stability and protecting the cell from rupturing. DNA is stored in the Nucleus, not a organelle.


The answer is Cytoplasm, C.

8 0
3 years ago
Read 2 more answers
Medicare legislation was established in the: <br> a. 1940s <br> b. 1950s <br> c. 1960s <br> d. 1970s
OLga [1]
It's answer C 1960s hope I helped
8 0
3 years ago
Read 2 more answers
Rhesus monkeys were exposed to lesioning of a specific brain area, and when they woke up they showed a pronounced decrease in th
andre [41]

Answer:

a. amygdala

Explanation:

According to my research on studies conducted by various neurologists, I can say that based on the information provided within the question the part of the brain that was most likely under investigation in this study was the amygdala. This can be said because the amygdala is the part of the brain that is responsible for emotions, survival instincts (which dictates fear levels), and memory.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

7 0
3 years ago
Almost all the South American and Central American
Vedmedyk [2.9K]

Answer:

O founder's effect

Explanation:

A founder effect can be defined as the loss of genetic variation when a new population is established from a few individuals. This process is known to increase the frequency of particular gene variants (alleles) at different <em>loci</em> when they are selectively neutral (or nearly neutral), and thereby such genes are fixed by genetic drift (i.e., through the random sampling of founder individuals). Interestingly, it has been discovered that the majority of South American and Central American Indians are nearly exclusively in the O blood group, which has been further associated with random genetic drift and a founder effect.

8 0
3 years ago
Endocrine glands are responsible for
erik [133]
You are right, it is B because, endocrine glands, as part of the endocrine system, they regulate and maintain a constant equilibrium in our bodies, known as homeostasis. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the primary function of cofactors?
    5·1 answer
  • What does polymerase chain reaction (PCR) do?
    13·1 answer
  • 15. Which is not a problem associated with the increased use of nuclear energy?
    10·1 answer
  • What is land breeze and sea breeze? If you can please do this in your own words.
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The person who introduced vaccination into Europe was a. Robert Koch. b. Louis Pasteur. c. Edward Jenner. d. Mary Montagu.
    8·1 answer
  • Explain the significance of the increased cell specialization of the volvocine line
    13·1 answer
  • Please answer if u know. dont answer if u dont. Corrrect answer gets branliest
    7·1 answer
  • Describe the parts of the building blocks of lipid
    13·1 answer
  • Why isn’t breathing considered a life function?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!