1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
4 years ago
6

Solve. x-3=-7 I don't understand what I'm supposed to put here

Mathematics
2 answers:
REY [17]4 years ago
8 0
X would equal negative four
butalik [34]4 years ago
3 0
Answer X is equal to -4
You might be interested in
90 cg 95 mg + 7g 12 cg 18 mg =
Ludmilka [50]
1cg=10mg, so 90cg95mg=90*10+95=995 mg. 7g=7*1000=7000mg, 12cg=12*10=120mg, so 7g 12 cg 18 mg =7000+120+18=7138mg, so <span>90 cg 95 mg + 7g 12 cg 18 mg=14138mg=14000mg+100mg+38mg=14g1cg38mg.</span>
4 0
4 years ago
What is 163.46 rounded to the newest tenth?
Levart [38]
It would be 163.5 because the hundredth place is higher than 5 so the 4 would round up one number
4 0
3 years ago
A store sells 4 T-shirts for $38.04. What is the unit cost per T-shirt?
julsineya [31]

Answer:9.51

38.04/4 = 9.51

Have a good day :)

4 0
3 years ago
Read 2 more answers
A certain fast food restaurant 77.5% of customers ordered items from the value menu if 14 customers are randomly selected what's
ivanzaharov [21]

Answer: 0.927

Step-by-step explanation:

Know that this is a binomial probability. In this case we want to find the probability of 9 to 14 success is inclusive where a successes a customer ordering from the value menu. This probability is the complement of the probability 0 to 8 successes inclusive. To determine the probability from a binomial distribution using Excel use the following steps. First press formulas and then insert function then select binomial distribution. Next enter the values for the number of successes, the number of trials, the number of success and the number of successes. In this case, enter 8, 14, and 0.775, in that order. Enter 1 for cumulative since this is a cumulative probability. Press OK. Excel should then display the probability. Here the resulting probability is 0.072766 which is 0.073 rounded to three decimal places. To find the probability of 9 to 14 customers ordering from the value menu subtract the previous probability from one. The probability is 1-0.073 which equals 0.927.

8 0
3 years ago
Helppppppppppppppppppppppppppppppppppppppppppppppp\<br>Due soonnnnnn T-T
Tju [1.3M]

Step-by-step explanation:

1)......mean= sum of observations/ total observations

= 5.2+8.4+4.3+6.7+5.8/5= 6.08

median= n=5(odd)=n+1/2=6/2=3rdterm= 5.8( when arranged in ascending order).....

mode= 3median- 2meam= 3×5.8-2×6.08= 5.24

range=8.4-4.3=4.1(when done A.O)

2)......mean= -2-13-13-5-7/5= -8

median= 3rd term= -5.....(n=5..odd)(when done A.o)

mode=largest frequency= -13

range= -13-(-2) = -13+2= -11(A.O)

3).....mean= sum/no.= 8+6+13/2+17/2+15/2+7+8+11/2+7+8//10=7.2

median=n=10(even)

=

mode= 8

range=8.5-5.5=3

median:==

(10/2)+(10/2+1)//2=5 term + 6term/2=7+7.5=14.5/2=7.25

4)....

5)...remove 62...then 73will be having highest frequency

3 0
3 years ago
Other questions:
  • Please explain!!<br> i need help with this
    14·1 answer
  • Find percent notation<br> 0.488
    14·1 answer
  • How do you solve this<br>​
    6·2 answers
  • Which expression is a difference of two terms that is equivalent to -6z + 13?
    5·1 answer
  • Assume that the cheetah travels an average of 40 mph to go from its resting place to a rock
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Did I choose the correct graph for the leading coefficient of -1/8?
    13·1 answer
  • PLZ HELP WILL MARK BRAINLIEST TO THE QUICKEST CORRECT ANSWER!
    7·1 answer
  • In parallelogram EFGH, EJ = 6x + 3 and JG = 10x - 5 What is EG?<br>A: 15<br>B: 12<br>C: 25<br>D: 30​
    11·2 answers
  • Solve:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!