How are the autotrophic protists different from the heterotrophic protists?

2 answers:

5 0

I think the correct answer from the choices listed above is option A. Autotrophic protists are different from the heterotrophic protists in a sense that the autotrophic protists can photosynthesize, while the heterotrophic protists cannot. Hope this answers the question.

____ [38]3 years ago

5 0

The right option is; A. The autotrophic protists can photosynthesize, while the heterotrophic protists cannot.

Protists are eukaryotic, microscopic organisms that may be unicellular or multicellular. In terms of feeding, some protists are autotrophic while some are heterotrophic. The difference between them is that the autotrophic protists produce their own food through the process of photosynthesis, while the heterotrophic protists cannot photosynthesize but they obtain their food by ingesting other organisms or decaying organic matter.

You might be interested in

Though plants, fungi, and prokaryotes all have cell walls, we place them in different taxa. Which of these observations comes cl

shtirl [24]

Answer:

Their cell walls are composed of very different biochemicals.

Explanation:

Biological classification is important to classify the organisms on the basis of their similarities and differences between them. Linnaeus is known as the father of biological classification.

Cellwall plays an important role in the maintenance of structure and function of the organisms. The composition of the cell wall of fungi, plants and prokaryotes are quite different. Plants cell wall made of cellulose, fungi has chitin in its cell wall and prokaryotes has different layers of cell wall.

Thus, the correct answer is option (D).

7 0

3 years ago

When electrons flow along the electron transport chains of mitochondria, which of the following changesoccurs?

Lerok [7]

B. The electron transport chain is the final step on cellular respiration in which 32 ATP is made and water

7 0

3 years ago

Assembling a complete sequence from fragment sequences

Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0

3 years ago

Flatworms use a system of canals and tubes with the ______ as their excretory organ.

Kazeer [188]

Flatworms use a system of canals and tubes with the mouth as their excretory organ. They belong to the Phylum Platyheminthes. Flatworms can be cut in half creating two individuals by binary fission. Binary fission is a type of asexual reproduction in which the offspring has the same features and characteristics of the parent. During binary fission, the DNA replicates into two and goes at the end of each membrane. And then the cell membrane divides into two daughter cells. Then cytokinesis follow.

6 0

3 years ago

Compare and Contrast the methods used to control microbial growth in daily life, healthcare settings, microbiology laboratories

Bas_tet [7]

Answer:

asdfgh

Explanation:

8 0

3 years ago