1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
11

You are a biologist on a trip to an island in the South Pacific. While there, you are allowed to collect DNA samples from a loca

l species of tortoise that resembles a species seen on a nearby continent. If your DNA analysis also indicates the two species are highly related, you might conclude that this was an example of _______________ through ________.
Biology
1 answer:
marshall27 [118]3 years ago
5 0

Answer:

The options

a. sympatric speciation; vicariance

b. allopatric speciation; vicariance

c. sympatric speciation; dispersal

d. allopatric speciation; dispersal

The CORRECT ANSWER IS d.

d. allopatric speciation; dispersal

Explanation:

Allopatric speciation takes place either via dispersal, when some members of a species shifts it's habitat to a separate geographical area which leads to differentiation of the initial group into separate diverse varieties or species(as in our case study).

Allopatric speciation through dispersal could results in multiple speciation leading to an individual original species producing diverse new species; this occurrence is called adaptive radiation.

In some scenario, a population of an individual species disperses all over a region with each locating a separate niche or isolated habitat. In the course of time, the diverse demands of their just formed lifestyles causes multiple speciation events that comes from a singular species.

You might be interested in
It would be amazing if you can help
Tom [10]
A) planets with long orbits

*all planets in groups 1 and 2 revolve around the sun!
*planets in groups 1 and 2 have moons
*group 2 have the fastest rotations

Our solar system is divided into two sections, the first section being the inner planets consisting of Mercury, Venus, Earth, and Mars.
The second section consists of Jupiter, Saturn, Uranus, Neptune, and Pluto.

The main differences between the two sections are distance from the sun. With the exception of Pluto, All outer planets are massive in comparison to the inner planets.
7 0
3 years ago
What makes up sediment? A Minerals and water/B Sea shells and oxygen/C Water and rock fragments/D Rock fragments and minerals
Georgia [21]
D rock fragments and minerals
5 0
3 years ago
Where does the first stage of respiration take place?
liberstina [14]

It takes place in cytoplasm

8 0
3 years ago
1. A population of 246 earthworms live in a 6 m2 garden. What is the population density? SHOW YOUR WORK.
NikAS [45]

Explanation:

you just need to know that :

population density = no of ( what is asked) / land area.

4 0
2 years ago
The process of plant respiration
sesenic [268]
I think it is C as plants take in Co2 and release oxygen which humans use to breathe.

☺️
4 0
3 years ago
Other questions:
  • Which molecule is the most common in the human body?
    15·2 answers
  • What mineral composition is most characteristic of intermediate rocks?
    6·1 answer
  • One of the disadvantages of experimental research is that __________.
    13·2 answers
  • Fill in the blank: Researchers who seek to replace damaged genes that cause inherited diseases or to genetically engineer bacter
    5·1 answer
  • What types of flowers produce the most nectar?
    7·1 answer
  • GETS BRAINILIST!!Which of the following should be included in a family communication plan? A directory of relatives' phone numbe
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Pros and cons for growing and selling GM (Genetically modified) food.
    7·1 answer
  • Which of the following is a BEHAVIORAL adaptation?
    6·1 answer
  • In order for our cells to metabolism N2 into 2NH3, a total of _____________ ATP is required.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!