1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolezko [41]
4 years ago
11

Why do some cells divide faster than others

Biology
1 answer:
Alona [7]4 years ago
8 0
Maybe because these particular cells die faster than other cells in the body, for example the receptors cells in your nasal cavity only lasts for about 3-4 weeks and after that it dies, therefore new news are formed every week in order to keep your nasal cavity from deteriorating your smell ability.
Some blood cells only lasts for about 120 days that's why new cells are formed and produced, faster production means faster cell division.

It depends on the type of cell and the current situation of those cells.
You might be interested in
Which substance is a compound?
bekas [8.4K]
Oxygen is a compound , phosphorus and nitrogen , and reservoirs

8 0
4 years ago
Read 2 more answers
Octopus and squid have chemoreceptors on their _____.
Natalija [7]
Octopus and squid have chemoreceptors on their tentacles. The correct option is the third option.
3 0
3 years ago
Which is produced when an egg and a sperm unite during a plant’s life cycle?
andrey2020 [161]

Explanation:

gametophyte

6 0
3 years ago
What process helps a young man regenerate his liver​
Llana [10]

Answer:

Liver regeneration is the process by which the liver is able to replace lost liver tissue from growth from the remaining tissue. The liver is the only visceral organ that possesses the capacity to regenerate. The liver can regenerate after either surgical removal or after chemical injury.Explanation:

8 0
3 years ago
A patient reports having shortness of breath and fatigue on brisk walking for the past 2 weeks. the patient has also experienced
Alex_Xolod [135]
<span>The patient is experiencing less oxygen in the blood. Menorrhagia is the same thing as a menstrual period, which can cause anemia. Anemia causes less oxygen flow due to a lower red blood cell count. The function of red blood cells s to carry oxygen throughout the body.</span>
7 0
3 years ago
Other questions:
  • How many cells does a fungi have?
    14·2 answers
  • Taller trees have a canopy arrangement of leaves where the upper leaves tend to be smaller than the ones below them. How does th
    7·1 answer
  • Kristen cut her hand on a piece of glass. As the blood clots, how do white blood cells prevent bacteria on the glass from infect
    15·2 answers
  • The Endangered Species Act protects individual species by
    8·1 answer
  • Just by looking at the color of a freshly drawn blood sample, how could you distinguish between blood that is well oxygenated an
    9·1 answer
  • What are trophic levels, apply them to tropical rainforest
    6·1 answer
  • Contains good bacteria that helps remove wastes
    12·1 answer
  • Which of the following is a biotic factor?
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • A blender can be used to break down the strawberry tissue in homogenization step. True False.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!