1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liula [17]
3 years ago
15

Why do the rate at which enzymes catalyze their reactions decrease when cellular atp levels are high

Biology
1 answer:
Zanzabum3 years ago
3 0
Xnnxhxhxhbzbzbndbdbx

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
China is a country that has been developing its cities, roads , sewage systemsand incereasing the education of womeneconomy is s
igomit [66]
It is a advance one
6 0
3 years ago
How could you test to see if soil temperature was responsible for a variation in flower color?
Anuta_ua [19.1K]
Take a White Flower and measure it with different soil temperatures and see if it changes colors. And don't forget to record the color and take a picture with different temperatures
6 0
3 years ago
Read 2 more answers
A.
snow_lady [41]

Answer:

A) Light pollution both attracts and repels migratory birds

In addition to the many hazards that exist in urban areas, cities typically lack the food resources and cover that birds need during migration or when raising their young. ... Darkening skies at night during migration season makes it easier for birds to navigate.

Explanation:

Migration carries high costs in predation and mortality, including from hunting by humans, and is driven primarily by availability of food. It occurs mainly in the northern hemisphere, where birds are funneled on to specific routes by natural barriers such as the Mediterranean Sea or the Caribbean Sea.

6 0
3 years ago
What did Watson and Crick’s model of DNA show?
taurus [48]
The double-helix shape of DNA.
6 0
3 years ago
Read 2 more answers
Other questions:
  • If an individual has 7 gene pairs, how many different gametes can be formed if two of the gene pairs are homozygous and the rema
    9·1 answer
  • A purebred chicken with white feathers is crossed with a purebred chicken that has black feathers. each of their offspring has b
    14·1 answer
  • In which direction is the Pacific Plate moving in relation to the North American Plate?
    14·2 answers
  • The type of protein-energy malnutrition characterized by a general lack of protein in the diet is called __.
    5·1 answer
  • In the 1960s, even though most of his friends tried recreational drugs, Sebastian refused to experiment. He did not think drugs
    10·1 answer
  • Three species of frogs—Lithobates pipiens, Lithobates clamitans, and Lithobates sylvatica—all mate in the same ponds, but they p
    7·1 answer
  • The white blood cell that activates the immune response and that is the primary target cell of hiv infection is called the _____
    13·2 answers
  • HELP!!! Explain why there are always more primary consumers in an ecosystem than tertiary consumers.
    5·1 answer
  • True or false During meiosis, the number of chromosomes in each cell stays the same.
    7·1 answer
  • Drag each tile to the correct box.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!