1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
9

Which type of Medicare policy requires insureds to use specific healthcare providers and hospitals (network providers), EXCEPT i

n emergency situations?a. preferredb. medicare select c. medicare advantage
Biology
1 answer:
Rus_ich [418]3 years ago
7 0

Answer:

The correct answer is option B. medicare select.

Explanation:

A Medicare select policy is a medicare policy that limits the coverage to the network of hospitals, doctors, and healthcare providers. This medicare plan allows the insured to negotiate with the healthcare providers so it is cost-effective as they charge less for their services.

Other plans given in options such as advantage medicare give a wide range of network of healthcare provider however they charge more than the medicare select plan.

Thus, the correct answer is option B. medicare select.

You might be interested in
What term is used to describe the
Elza [17]
B. population density

Explanation: took Biology
8 0
3 years ago
Read 2 more answers
3. Why are cilia and flagella important?
mr Goodwill [35]

Answer:

Involved in the movement of body and capturing of food

Explanation:

3 0
3 years ago
Early classification systems consisted of two kingdoms; plantae and animalia. what scientific development allowed taxonomists to
Ulleksa [173]
If you go to book and search you will find your answer
7 0
4 years ago
NEED HELP ASAP
Oxana [17]
A.) zygote > Implantation > fetus > childbirth
5 0
4 years ago
A mosquito goes through complete metamorphosis. In this life cycle which stage comes after the egg stage?
zysi [14]

Answer:

A.Pupa

Explanation:

The four stages are egg, pupa, larva, and adult. The full life-cycle of a mosquito takes about a month.

7 0
3 years ago
Read 2 more answers
Other questions:
  • The chief distinguishing characteristic of all mammals is the presence of
    14·1 answer
  • Explain Mendel's law of segregation and how it predicts the 3:1 dominant-to-recessive phenotypic ratio among the F2 generation o
    13·1 answer
  • Once you have stopped for a school bus, do not pass until the driver signals you to proceed, the red lights stop flashing,
    10·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • 1. Why did you use a pencil to mark the paper and not a pen? 2. Why do you have to use a different capillary tube for each sampl
    6·1 answer
  • Which on the following describes a cyclical change in an ecosystem?
    7·1 answer
  • What function do proteins perform in the cell membrane
    14·1 answer
  • Continue building the strand of mRNA until you have used all of the RNA nucleotides. What is the nucleotide sequence of the mRNA
    10·1 answer
  • <img src="https://tex.z-dn.net/?f=%7B%5Chuge%5Cpink%7B%5Cfbox%7B%7B%E0%BF%90Define%20Blood%20Pressure%E0%BF%90%7D%7D%7D%7D" id="
    8·2 answers
  • Scientific research shows that our global climate is changing. The global sea level is rising and ocean temperatures are increas
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!