For mutations to affect an organism's descendants, they must: 1) occur in cells that produce the next generation, and 2) affect the hereditary material. Ultimately, the interplay between inherited mutations and environmental pressures generates diversity among species.
Enzymes can be denatured by irregular PH. Meaning that they can change shape. Enzymes rely on their shape in order to function so if their shapes change because of the PH then the active sites don't fit anymore and they enzymes wont work.
Answer:
In anaerobic respiration, which occurs during fermentation, less energy is extracted — only two ATP molecules per glucose molecule — because the products of the process, such as ethanol or lactic acid, contain more energy than does carbon dioxide, the product of aerobic respiration
Happy to help
Pls Mark As Brainliest.
Answer:
c) allowing an organism to adjust to changes in environmental conditions
Explanation:
A stimulus can be defined as any change in the external or internal environment that produces a corresponding response in the organism. These responses enable the organism to maintain an internal equilibrium (homeostasis). Gene expression in prokaryotes, which are the simplest forms of life, is highly regulated by environmental stimuli. Some examples of stimuli known to regulate gene expression patterns in prokaryotic organisms are light, water, pressure, temperature, etc.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
