1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
3 years ago
12

Kevelyn dreams that 12 monkeys are dancing in a circle around her while she sits on a stool and eats a banana. This description

of Kevelyn’s dream contains _________ content.
A. transference

B. latent

C. lucid

D. manifest
Biology
1 answer:
Volgvan3 years ago
8 0

Its probably B, as latent dreams are influenced by previous experiences and actions, and usually has a meaning. If not, its possibly D.

I hope my answer helps with this weird question lol

You might be interested in
Name the waste product formed from the breakdown of amino acids, which is transported around the body in the blood plasma.
RideAnS [48]

Answer:

UREA

Explanation:

6 0
3 years ago
Read 2 more answers
What are the three parts of all seeds?
yarga [219]
The embryo, endosperm and seed coat.
3 0
3 years ago
Read 2 more answers
Scientific modles can never be changed. True or False
Lerok [7]

Answer:

False

Explanation:

5 0
3 years ago
Tropical climates exist between which of the following latitudes?
irina [24]
Tropical climate is a region of the earth surrounding the equator.  When the earth is exposed to light from the sun it is right over the equator and up 23 degrees of latitude Tropic of Cancer in the northern hemisphere and Tropic of Capricorn in the southern hemisphere
3 0
3 years ago
What are four types of tissues found in the human body? How are they classified?
olga2289 [7]
<span>connective epithelial muscular <span>nervous</span></span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • During inspiration, after leaving the larynx, air enters the __________.
    10·1 answer
  • Is a dragon fly a insect
    7·2 answers
  • Como é chamado no Brasil um profissional que estudou ciência política ou antropologia?
    13·1 answer
  • What is the role of science in society?
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which level of organization refers to all the type of environments in which organisms can be found?
    5·2 answers
  • Anyone have a clue what dog breed this is?
    6·2 answers
  • The non essential part of a flower are the​
    15·1 answer
  • Which has a lower density? <br><br> rhyolite<br> Or<br> basalt
    15·2 answers
  • Could someone please come help me
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!