1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
9

Given the linear equation 4y = 8x - 3, find the y-intercept

Mathematics
2 answers:
Anarel [89]3 years ago
6 0
The <span>y-intercept is -3/4

</span>
Yuliya22 [10]3 years ago
6 0
Y-intercept = (0,y)
x = 0 , solve for y
4y = 8x - 3
4y = 8(0) - 3
4y = 0 - 3
y = -3/4
y-intercept is (0 , -3/4)
You might be interested in
Jason and his friends want to go bowling on Friday night. Southgate Bowling Alley charges $30 shoes and $6 per hour to bowl, whi
alekssr [168]

Answer:

2 hours

Step-by-step explanation:

Slope represents the hourly rate.

Constant represents initial price.

y = 30 + 6x \\ y = 36 + 3x \\ 30 + 6x = 36 + 3x \\ 3x = 6 \\ x = 2

3 0
2 years ago
How do you reverse 16 / 4
Llana [10]
Divide and if u divide by 4 it would be 4/1 so the it the answer would be 4
7 0
2 years ago
2. Two angles have a common vertex but no common side. How can you tell whether the angles are vertical angles?
Maksim231197 [3]

Explanation:

The angles are <em>vertical angles</em> if the opposites of the rays forming one of the angles are the rays forming the other angle.

More formally, if V is the common vertex, and ...

  • R is a point on one of the rays forming Angle 1
  • S is a point on the ray that is the opposite of ray VR
  • T is a point on the other ray forming Angle 1
  • U is a point on the ray that is the opposite of ray VT

Then angle RVT and angle SVU are vertical angles.

___

Another way to say this is that points R, V, S are collinear, as are points T, V, U, and the two angles of interest are RVT and SVU.

If the above conditions cannot be met, then the angles are not vertical angles.

7 0
3 years ago
PLEASE ANSWERRRRRRRRRRRRRRRRRRRRRRRR
tekilochka [14]

Answer:

a=11, b=53

Step-by-step explanation:

y=ax+b

x=1, y=64 -> 64=a+b

x=2, y=75 -> 75=2a+b

75-64=a, a=11, b=53

All the other points obey this rule.

8 0
3 years ago
Read 2 more answers
12. A bag contains 12 red, 9 green and 5 black markers. If Cooper randomly selects 7 markers, how many
ASHA 777 [7]

Answer:

Step-by-step explanation:

7 marks

6 same colors

from 12 red 6 same exactly the same

12 x 11 x 10 x 9 x7 x6

1 remainig

from 9 green 6 saem exactly the same

9 x 8 x 7 x 6 x5 x4

1 remaining

add the results above to get your final answer

26 markers in total

6 to be chosen of the same color from 7

8 0
1 year ago
Other questions:
  • Write 91.4 million in both standard form and in scientific notation
    6·2 answers
  • A room is 12 m long and 8 m wide and 10 m high, find the area of the room​.
    5·1 answer
  • 100, 119, 103, 111, 110, x, mean 116
    6·1 answer
  • Write an equation for the line on the graph below:​
    5·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Can someone please help me​
    14·1 answer
  • If you take a class and have three marking periods in the class and in the first period your average grade was a 85.56 the secon
    5·1 answer
  • Which of the following are solutions to the system shown below? Select all that apply. a (0,-1) b (1,0) C (0,0) d (3,4) e (0,1)​
    13·1 answer
  • Abe is buying wrapping paper.
    14·2 answers
  • Find the nth term of the sequence 4, 7, 10, 13, …
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!