1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yKpoI14uk [10]
3 years ago
12

Nitric oxide (NO) reacts readily with chlorine gas as follows.2 NO(g) + Cl2(g) equilibrium reaction arrow 2 NOCl(g)At 700. K the

equilibrium constant Kp for this reaction is 0.26. Predict the behavior of each of the following mixtures at this temperature and indicate whether or not the mixtures are at equilibrium. If not, state whether the mixture will need to produce more products or reactants to reach equilibrium.(a) PNO = 0.16 atm, PCl2 = 0.30 atm, and PNOCl = 0.11 atm.(b) PNO = 0.12 atm, PCl2 = 0.10 atm, and PNOCl = 0.048 atm.(c) PNO = 0.15 atm, PCl2 = 0.15 atm, and PNOCl = 5.20 10-3 atm.
Chemistry
1 answer:
Yanka [14]3 years ago
8 0

<u>Answer:</u>

<u>For a:</u> The mixture will need to produce more reactants to reach equilibrium.

<u>For b:</u> The mixture will need to produce more reactants to reach equilibrium.

<u>For c:</u> The mixture will need to produce more products to reach equilibrium.

<u>Explanation</u>:

For the given chemical equation:

2NO(g)+Cl_2(g)\rightleftharpoons 2NOCl(g)

The expression of K_{p} for above equation follows:

K_{p}=\frac{(p_{NOCl})^2}{(p_{NO})^2\times p_{Cl_2}}   .....(1)

We are given:

Value of K_p = 0.26

There are 3 conditions:

  • When K_{p}>Q_p; the reaction is product favored.
  • When K_{p}; the reaction is reactant favored.
  • When K_{p}=Q_p; the reaction is in equilibrium.

For the given options:

  • <u>For a:</u>

We are given:

p_{NOCl}=0.11atm\\p_{NO}=0.16atm\\p_{Cl_2}=0.30atm

Putting values in expression 1, we get:

Q_p=\frac{(0.11)^2}{(0.16)^2\times 0.30}=1.57

As, K_{p}; the reaction is reactant favored

Hence, the mixture will need to produce more reactants to reach equilibrium.

  • <u>For b:</u>

We are given:

p_{NOCl}=0.048atm\\p_{NO}=0.12atm\\p_{Cl_2}=0.10atm

Putting values in expression 1, we get:

Q_p=\frac{(0.048)^2}{(0.12)^2\times 0.10}=1.6

As, K_{p}; the reaction is reactant favored

Hence, the mixture will need to produce more reactants to reach equilibrium.

  • <u>For c:</u>

We are given:

p_{NOCl}=5.20\times 10^{-3}atm\\p_{NO}=0.15atm\\p_{Cl_2}=0.15atm

Putting values in expression 1, we get:

Q_p=\frac{(5.20\times 10^{-3})^2}{(0.15)^2\times 0.15}=0.008

As, K_{p}>Q_p; the reaction is product favored.

Hence, the mixture will need to produce more products to reach equilibrium.

You might be interested in
What causes damage to the ozone layer?
ryzh [129]
<span>Chlorofluorocarbons (CFCs) can damage the ozone layer.</span>
3 0
3 years ago
Read 2 more answers
A solution contains 0.021 M Cl and 0.017 M I. A solution containing copper (I) ions is added to selectively precipitate one of t
lidiya [134]

<u>Answer:</u> Copper (I) iodide will precipitate first.

<u>Explanation:</u>

We are given:

K_{sp} of CuCl = 1.0\times 10^{-6}

K_{sp} of CuI = 5.1\times 10^{-12}

Concentration of Cl^-\text{ ion}=0.021M

Concentration of I^-\text{ ion}=0.017M

Solubility product is defined as the product of concentration of ions present in a solution each raised to the power its stoichiometric ratio.

  • <u>For CuCl:</u>

K_{sp}=[Cu^+][Cl^-]

Putting values in above equation, we get:

1.0\times 10^{-6}=[Cu^+]\times 0.021

[Cu^+]=\frac{1.0\times 10^{-6}}{0.021}=4.76\times 10^{-5}M

Concentration of copper (I) ion = 4.76\times 10^{-5}M

  • <u>For CuI:</u>

K_{sp}=[Cu^+][I^-]

Putting values in above equation, we get:

5.1\times 10^{-12}=[Cu^+]\times 0.017

[Cu^+]=\frac{5.1\times 10^{-12}}{0.017}=3.00\times 10^{-10}M

Concentration of copper (I) ion = 3.00\times 10^{-10}M

For the precipitation of copper (I) ions, we need less concentration of copper (I) ions. So, copper (I) iodide will precipitate first.

7 0
3 years ago
Is gold a compound or an element
timurjin [86]
Gold is an element (Au) you can identify it on a periodic table
3 0
3 years ago
What would happen to a weak base dissociation equilibrium if more products
Elina [12.6K]

Answer:

Both B and D are correct.

Explanation:

B + H₂O ⇌ BH⁺ + OH⁻

If you add more products, the position of equilibrium will shift to the left to decrease their concentrations (Le Châtelier's Principle). The concentration of reactants will increase, but the equilibrium concentrations of products will also be higher than they were initially.

A is wrong. The equilibrium constant is a constant. It does not change when you change concentrations.

C is wrong. Per Le Châtelier's Principle, the concentrations must change when you ad a stress to a system at equilibrium.

(This is a poorly-worded question. "They" are probably expecting answer D.)

6 0
3 years ago
Read 2 more answers
Why Ca(OH)2 is a base?
Ray Of Light [21]
Calcium Hydroxide (Ca(OH)2) or slaked lime is a base because in aqueous solution of slaked lime there are hydroxide ions available due to the dissociation of electrolyte (Ca(OH)2).
7 0
3 years ago
Other questions:
  • Night-vision goggles allow you to see warm objects in a dark environment. Which type of electromagnetic wave do they detect?
    15·1 answer
  • Which of these is an example of a physical change? Question options: melting a substance breaking chemical bonds forming chemica
    12·2 answers
  • A(n) _____ reaction is a reaction in which an acid and a base react in an aqueous solution to produce a salt and water.
    6·1 answer
  • The rotational period of the moon is_____
    11·1 answer
  • DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
    6·1 answer
  • Which of the following feedbacks can be either positive or negative?
    12·1 answer
  • Suppose you want to make an acetic acid/acetate buffer to a pH of 5.00 using 10.0 mL of 1.00 M acetic acid solution. How many mi
    8·1 answer
  • What else can copper react with?
    15·2 answers
  • Question 1 of 10
    15·1 answer
  • 1. Name three obstacles that Mendeleev faced in his life? ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!