1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
4 years ago
15

What would be the max heart rate of this sport?

Health
1 answer:
Marat540 [252]4 years ago
5 0
It is recommended that you exercise within 55 to 85 percent of your maximum heart rate<span> for at least 20 to 30 minutes to get the best results from aerobic exercise</span>
You might be interested in
When driving through a curve at a speed higher than the posted speed limit, your vehicle will need more?
leva [86]
Im pretty sure it is traction, or weight distribution equally on all the axles wetheer 2 or 8
5 0
4 years ago
Which type of lipids are considered to be heart-healthy and associated with reduced inflammation?
Olegator [25]

Unsaturated fats are lipids that are considered to be heart-healthy and associated with reduced inflammation.

  • Healthy fats are those that are unsaturated. They lower inflammation, reduce cholesterol, and normalize heart rhythms, according to research.
  • They are composed of carbon atom chains with a reduced number of hydrogen atoms connected due to the presence of one or more double bonds. They are often liquid at ambient temperature due to their structure.
  • Saturated fats, on the other hand, are "saturated" with hydrogen atoms, which means they have the most hydrogen atoms surrounding the carbon atoms. At room temperature, saturated fats are normally solid.
  • Because they raise bad cholesterol, saturated fats have long been associated with an increased risk of cardiovascular disease (LDL).
  • Unsaturated fats, which are liquid at room temperature, are regarded as healthy fats because they have a range of positive effects on health, including <u>lower blood cholesterol levels, less inflammation, stable cardiac rhythms,</u> and more.

learn more about Unsaturated fats here: brainly.com/question/4073863

#SPJ4

3 0
2 years ago
What is a possible consequence of abusing intravenous drugs such as heroin?
kondaur [170]

Answer:

HIV transmission is correct for ape.x

Explanation:

7 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
A food worker is pouring sanitizing solution into spray bottles.
notka56 [123]

Explanation:

C.clearly label the bottles with the name of the chemical.

Plz give BRAINLIEST if possible.

4 0
3 years ago
Other questions:
  • The Flynn effect is thought to be caused by all of the following except __________.
    9·2 answers
  • Select all that apply. Which are examples of chronic stress? life-long illness a fight with a friend moving to a new home financ
    11·2 answers
  • What are the six areas of wellness and how can they be incorporated into one's daily life?
    6·2 answers
  • A cracked pan is a food safety hazard because
    11·1 answer
  • What are the four causes of mental disorder
    9·2 answers
  • Select the correct answer from each drop-down menu.
    6·1 answer
  • Loss of power can affect multiple operations within a hospital. Which of the following components of a disaster plan should desc
    13·1 answer
  • I needed help with an assignment, but I was turned down by my mom and dad. When I went to do my assignment, I was frustrated, an
    15·1 answer
  • What is the ideal depth of chest compressions for a newborn?
    15·1 answer
  • You go to the doctor and find out that your blood pressure is too high. What can you do to lower your blood pressure and lower y
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!