Which food chain sequence can be found in this meadow?

Biology

1 answer:

Vikki [24]3 years ago

7 0

Answer:

The correct answer is "grass -> grasshopper -> raccoon -> wolf"

Explanation:

Food chains are diagrams that represent the order at which organisms feed from each other, starting from producers that are able to make their own food, until quaternary consumers that feed from predators. In this case, the sequence of grass -> grasshopper -> raccoon -> wolf can be found in the meadow. Grass is a plant that function as producer, which is consumed by grasshopper (primary consumer), which is consumed by raccoon (secondary consumer), which is consumed by wolf (tertiary consumers). I attached the missing information in a picture.

You might be interested in

What are the layers of your skin called?

topjm [15]

Your skin has 3 layers. The top layer is called the epidermis. The middle layer is called the dermis. The bottom layer is called the subcutaneous fat.

4 0

3 years ago

Read 2 more answers

Organisms are discovered to be living in a deep-sea trench. They are most likely _____.

Brilliant_brown [7]

I think its the c. archaebacteria because there are hundreds of species of archaebacteria living under the sea.....
and bacteria is harmful to all lifes of species..

4 0

3 years ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago

Which Statement is true of Homo sapiens?

Karo-lina-s [1.5K]

<span>B. The have been Earth's only hominine for the last 24,000 years.

After the unknown eradication of the Homo Neanderthals, Homo Sapiens became the only homonine for the last 24,000 years. That is to say, that modern humans are the result of the evolution of homo sapiens to homo sapiens sapiens.</span>

3 0

3 years ago

During a flood, many individuals in a population of gophers drowned. Which effect of an environmental change does this best illu

yan [13]

During a flood, many individuals in a population of gophers drowned. Which effect of an environmental change does this best <span>illustrate? The answer is DEATH</span>

5 0

3 years ago

Read 2 more answers