1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
3 years ago
12

Given the sequence ATGGCGAATCACGTCACTTGA

Biology
1 answer:
Marina86 [1]3 years ago
4 0

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

You might be interested in
Which example is a trace fossil?
enot [183]

Answer:

B.) Dinosaur footprint

4 0
3 years ago
PLS HELP ME NEED THE ANSWER TODAY 50POINTS !.☺♥When would be a good time in San Francisco to collect seashells? Explain your ans
SpyIntel [72]

Answer: a low tide I would say around 5:02a.m.

Explanation:

The best shelling opportunities tend to happen during low tide, where the shells that are normally covered by water are left exposed on the sand.

7 0
3 years ago
On a tour of African countries, Mark contracts a bad case of traveler's diarrhea. Because he can't eat very much, his body start
melomori [17]
<h2>e) option is correct </h2>

Explanation:

Traveler's diarrhea is an intestinal infection that occurs as a result of eating or drinking contaminated food or water, food handlers who do not wash their hands after they use the bathroom can transmit the infection to people who consume the contaminated food

Due to diarrhea, kidney don't work properly and level of urea increases in blood

Due to the low carbohydrate intake, ketosis occurs in which stored fat is metabolized which results in build up of acids called ketones

If the body starts to use energy sources other than carbohydrates then it means it is using the stored energy, gluconeogenesis fulfills glucose requirement of cell by synthesis of glucose from non carbohydrate material

To supply with energy lipid metabolism occurs, fatty acids are oxidized and energy in the form of ATP is produced

7 0
3 years ago
A unique characteristic of mammals is that they _____.
katovenus [111]
A. have hair
--------------
5 0
3 years ago
Read 2 more answers
Describe matter and elements
Masteriza [31]

Answer:

The term matter refers to something that consumes space and has mass, the "stuff" of which the universe is made, in other words. All matter consists of substances called atoms, which have different chemical and physical properties and can not be broken down by ordinary chemical reactions into other substances.

Explanation:

5 0
3 years ago
Other questions:
  • Use the Internet to research a specific case where radiometric dating was instrumental in a significant archeological discovery.
    10·1 answer
  • Which of the following factors is used to distinguish the two main aquatic biomes?
    8·2 answers
  • Help with these questions
    10·1 answer
  • During El Niño, warm water moves from Australia to the coast of South America. Which change does this cause to Australia?
    15·1 answer
  • A hiker enters an area where lichens, mosses, and fungi are growing. Which statement best describes this ecosystem?
    9·1 answer
  • Scientists agree that changes in atmospheric gases may what?
    14·2 answers
  • I have all day, last class! answer ASAP!!!
    12·2 answers
  • Which scenario describes an interaction between two of Earth’s spheres?
    13·2 answers
  • A shoreline's first line of defense against hurricanes is​
    14·1 answer
  • HELPPPP!!! <br> G:Green <br> B:Blue <br> -what percent of the offspring will have green skin???-
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!