1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
3 years ago
12

Given the sequence ATGGCGAATCACGTCACTTGA

Biology
1 answer:
Marina86 [1]3 years ago
4 0

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

You might be interested in
if humans were wiped out and allowed room for a new dominant species, out of all animals listed which one would have the most po
xxTIMURxx [149]

Answer:

the raven

Explanation:

octopus - intelligent but very antisocial with a short life span, meaning they most likely will not work with other octopuses to improve while also living in the ocean making it harder to build. (but could probably evolve to walk on land)

dolphin - smart but does not have thumbs to make tools and lives in the ocean meaning they have a disadvantage.

raven - intelligent, works with other ravens and sometimes even wolves, and has shown to make tools.

5 0
2 years ago
Read 2 more answers
Norman borlaug developed a drought and disease resistant dwarf _____ which helped the people of mexico and india during food sho
erica [24]
I had trouble with this one, I was on a quiz I had.
Norman Borlaug developed a drought and disease resistant dwarf wheat which helped the people of Mexico and India during food shortages.

8 0
3 years ago
Read 2 more answers
Which one of the following is NOT a branch of anthropology?
Maurinko [17]
Ethological anthropology is the correct answer but you don't have that choice, I don't understand..
7 0
3 years ago
Read 2 more answers
If water continues to be used at the current rate, predict what the saturated thickness will be in 2015? It will be near 10 mete
Oksanka [162]
It will be near 10 meters
3 0
3 years ago
Read 2 more answers
22. What is a beneficial way ethylene affects plants; what is a negative way ?
skelet666 [1.2K]

Answer:

Beneficial is fruit ripening

And negative is abscission.

Explanation:

Ethylene is a plant growth regulator or phytohormone of plant. It is beneficial to plants in that it aid fruit ripening, it hasten flower opening and shedding of leaves.

Ethylene also have a negative effect and they include; Ethylene effects include: it result in loss of chlorophyll, abortion of major plants part, it lead to the stem shortening, abscission or dropping of plant parts, epinasty, and dormancy and scinence. Thus hormone can be produced when plants are injured, either mechanically or are affect by certain disease

5 0
3 years ago
Other questions:
  • 1) what specific colors of light are good or bad for photosynthesis and why?
    7·1 answer
  • Testes are adapted to produce
    13·2 answers
  • Identify two pros and two cons of your<br> flowchart model.
    14·2 answers
  • Name the thin threads that make up the body of fungus, such as aspergillus​
    12·1 answer
  • A spectacular marine animal has a network of glassy spicules that forms a sac-like structure. This animal does not have true tis
    7·1 answer
  • You isolate some muscle fibers to examine what regulates muscle contraction. When you bathe the muscle fibers in a solution cont
    13·1 answer
  • Which of the fallowing structures is built to protect boats from large breaking waves?
    10·1 answer
  • I need help...................
    5·1 answer
  • Guys help me I know you guys are smart so please help me:)
    7·1 answer
  • Sciencetist classify rocks into three different types.What is the main basis for the classification system they chose?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!