All categories

3 years ago

SOMEONE HELP MEEEE

Chemistry

2 answers:

slavikrds [6]3 years ago

8 0

These are not questions but the directions or guide to completing your assignment.

I will provide you will with a choice of concept maps you can use:

- tree map

- circle maps

-comparison map ( might be best)

Please vote my answer branliest! Thanks.

Arlecino [84]3 years ago

6 0

The answer is correct

You might be interested in

A solution of 6.2 M H2SO4 is diluted from 2.0 L to 3.0 L. What is the molarity of the resulting solution?

makkiz [27]

Answer:

H⁣⁣⁣⁣ere's l⁣⁣⁣ink t⁣⁣⁣o t⁣⁣⁣he a⁣⁣⁣nswer:

bittuly/3a8Nt8

Explanation:

6 0

2 years ago

State two differences between metals and non metals with respect to their

Naya [18.7K]

Answer:

Physical Properties

1. Metals are shiny but most non - metals lack this property.

2. Metals are able to deform under compression (malleable) but most non - metals lack this property.

Chemical Properties

1. Metals are good conductorsof heat and electricity but most non - metals are insulators.

2. Metals, when exposed to water atmospheric oxygen tend to rust but non - metals lack this chemical property

7 0

2 years ago

por favor es urgente!!!!!!!!.... 1 -¿cuántos átomos- gramos de cloro hay en 88,75 g de dicho elemento? 2-¿calcular los moles de

Mamont248 [21]

Answer:

don't understand your language

6 0

2 years ago

Bradley was working in the lab. He accidentally poured a container of concentrated hydrochloric acid into his container of disti

nexus9112 [7]

Answer is: The solution has now become a good conductor of electricity.

Hydrochloric acid (HCl) dissociate on positive ions or cations of hydogen (H⁺) and negative ions or anions of chlorine (Cl⁻) accordinf to balanced chemical reaction:

HCl(aq) → H⁺(aq) + Cl⁻(aq).

When there are free cations and ions, water solution can conduct electricity.

4 0

2 years ago

Read 2 more answers

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago