1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
4 years ago
8

Check the area that applies to a mesomorph body type. select one:

Biology
1 answer:
castortr0y [4]4 years ago
7 0

The correct answer is a. trim waist

Someone with a mesomorph body type has a large structure of bone, muscles and also a natural athletic physique. This is the best body type for bodybuilding. And it is easy for them to gain or lose weight. They are also naturally strong.

You might be interested in
Why does a delta often form where a river meets the ocean?
SVETLANKA909090 [29]
<span>When river water is no longer flowing downhill, the water slows down. This makes sediment drop to the bottom. Sediment deposited where a river flows into an ocean or lake builds up and a landform called a delta is formed.</span>
5 0
3 years ago
Read 2 more answers
The sun is the ______ source of energy for hetertrophs
yan [13]

Answer:

main (let me know if I am wrong but that seems right) can I get brainliest please? (rate 5 stars please)

Explanation:

7 0
4 years ago
What are 3 structures are found in every living cells?
stepan [7]

Answer:

Golgi apperatures

Mitochondria

Smooth and Rough ER.

7 0
4 years ago
4. Birth rates in a population, such as the Moose on Isle Royale, can be affected by all of the following EXCEPT
shtirl [24]
The answer should be d
6 0
3 years ago
Read 2 more answers
explain : in order to get rid of any effects of agricultural insecticides in the fruits, it is advised to soak them in a diluted
Vedmedyk [2.9K]

As we have studied in junior classes <em>that all animals including bacteria contain a plasma membrane around their cell which controls the movement of water and materials to and from the cell.</em>

The bacteria are the main hazard in pesticides and if we study about its structure, it contains both cell membrane and cell wall. Now another point in that bacteria lives in a moist or hypotonic environment in which the concentration of water inside the cell is less than the concentration of water outside the cell. This results in more movement of water from outside to inside the cell since we know that water moves from a place of higher concentration to a place of lower concentration.

Now when the water moves inside the bacterial cell, it can burst bacterial cell but thanks to the presence of cell wall which donot lets the burst caused.

So coming towards sugar solution, when bacteria are dipped in dilute sugary , the outside environment around a cell is sugary, and the concentration of water in the solution is less than inside the cell and water tends to leave the cell. the major effect of sugary solution is that it withdraws water from inside the body of micro organisms if the external concentration of sugar is high enough. When the water will move out of their body, they will die and their spores will not be able to germinate too.

This will eventually make our food (vegetable, fruit or any other) clean.

Hope it helps!

8 0
4 years ago
Other questions:
  • Circle the 3 water molecules on the image
    15·1 answer
  • What do waves not take with them as they travel
    8·2 answers
  • A population that grows until it reaches its carrying capacity usually has the shape of what
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • An energy pyramid shows the amount of<br> available at each feeding level in an ecosystem
    15·2 answers
  • Define ethics and describe why it is so important for science
    6·1 answer
  • How do you think the sequence of amino acids in an enzyme relates to its ability to bind to a specific target molecule?
    6·2 answers
  • I will give you Brainliest if you answer this problem!
    9·1 answer
  • The diagram shows different forms of thermal energy transfer. What do the flames below the pot represent?
    9·1 answer
  • What is the genotype and phenotype for A male hemophiliac with a woman pure for normal clotting.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!