All categories

3 years ago

Form a hypothesis about how the loss of estuaries can increase erosion along shorelines

Biology

1 answer:

lakkis [162]3 years ago

3 0

Answer:

The hypothesis can be made as follows:

' If there are less or no estuaries in a river, then there will be more erosion at the shorelines.'

A hypothesis is a tentative statement which can either be supported through experiments or proven to be wrong.

In the following scenario, we can conduct experiments by taking into observation those rivers which have estuaries and those which do not have estuaries. We can then compare the erosion of the shorelines of the rivers to validate our hypothesis.

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

How would cell division heal a broken arm

arsen [322]

Answer:

In order for a fracture to heal, the bones must be held in the correct position and protected. Soon after a fracture occurs, the body acts to protect the injured area, and forms a protective blood clot and callus around the fracture. New "threads" of bone cells start to grow on both sides of the fracture line.

Explanation:

6 0

2 years ago

Help <br> Nucleic acid <br> Certain protein<br> Cell membranes<br> Certain carbohydrates

viktelen [127]

Certain Protiens, amino acids form protiens

8 0

3 years ago

What could be the blood type of the unknown person in row one of the diagram? Select all that apply. A. Type A B. Type B C. Type

Marta_Voda [28]

I think I found your question online and if the questions are the same, the answers would be A. B. and C. Once again, you do not have to take this answer because I am unsure if I found the same chart that you have.

8 0

3 years ago

Which of the following is the role of rough ER

cestrela7 [59]

The rough ER is involved with protein synthesis. It helps to produce proteins and help them fold properly.

8 0

3 years ago

Form a hypothesis about how the loss of estuaries can increase erosion along shorelines​

Form a hypothesis about how the loss of estuaries can increase erosion along shorelines