1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
11

Form a hypothesis about how the loss of estuaries can increase erosion along shorelines​

Biology
1 answer:
lakkis [162]3 years ago
3 0

Answer:

The hypothesis can be made as follows:

' If there are less or no estuaries in a river, then there will be more erosion at the shorelines.'

A hypothesis is a tentative statement which can either be supported through experiments or proven to be wrong.

In the following scenario, we can conduct experiments by taking into observation those rivers which have estuaries and those which do not have estuaries. We can then compare the erosion of the shorelines of the rivers to validate our hypothesis.

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
How would cell division heal a broken arm
arsen [322]

Answer:

In order for a fracture to heal, the bones must be held in the correct position and protected. Soon after a fracture occurs, the body acts to protect the injured area, and forms a protective blood clot and callus around the fracture. New "threads" of bone cells start to grow on both sides of the fracture line.

Explanation:

6 0
2 years ago
Help <br> Nucleic acid <br> Certain protein<br> Cell membranes<br> Certain carbohydrates
viktelen [127]
Certain Protiens, amino acids form protiens
8 0
3 years ago
What could be the blood type of the unknown person in row one of the diagram? Select all that apply. A. Type A B. Type B C. Type
Marta_Voda [28]

I think I found your question online and if the questions are the same, the answers would be A. B. and C. Once again, you do not have to take this answer because I am unsure if I found the same chart that you have.

8 0
3 years ago
Which of the following is the role of rough ER
cestrela7 [59]

The rough ER is involved with protein synthesis. It helps to produce proteins and help them fold properly.

8 0
3 years ago
Other questions:
  • Are grapes poisonous for dogs?
    12·2 answers
  • How is a cytoskeleton like your muscles
    13·1 answer
  • How are transcription and translation related to the central dogma of molecular biology
    7·1 answer
  • In 1668, Francesco Redi conducted an experiment with jars of meat. This experiment was noteworthy because it _____.proved that m
    6·2 answers
  • *GIVING BRAINLIEST. PLEASE HELP<br><br> Q: What trend in the monarch population does the graph show?
    14·1 answer
  • There is enough renewable energy available given current technologies to meet
    11·2 answers
  • Ape species began to dwindle during the Miocene, leaving only a few remaining: a situation that exists up to the present. It is
    5·1 answer
  • While doing field work in Madagascar, you discover a new dragonfly species that has either red(R) or clear(r) wings. Initial cro
    11·1 answer
  • What is the evolutionary advantage of the Guinea worm?
    9·1 answer
  • What is the most likely explanation for wes's observations?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!