1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verdich [7]
3 years ago
8

What could prevent sperm from reaching and fertillizing an egg?

Biology
1 answer:
Aleks04 [339]3 years ago
6 0
Numerous barriers can prevent sperm from reaching and fertilizing the egg, this can be that the Sperm may be defected, or lack the required number of mitochondria needed to help move the sperm. Also, if sperm had already fertilized the egg, there is a change that takes place to the membrane surrounding the egg preventing further sperm from fertilizing.
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Do protists have cell walls? If so, what is it made of?
Umnica [9.8K]
Yes, protists have cell walls.

Protists cell walls are made of composed cellulose, protein strips , and silica

For some protists, we can even found components like pectin on the cell walls

hope this helps
6 0
3 years ago
Read 2 more answers
What’s the correct answer for this ?
e-lub [12.9K]

Answer:

Cos(89)

Explanation:

Trust me Im right. I got this answer by calculating what decimal sin(1) is then saw which answer choice equals the same answer

3 0
2 years ago
Does a substance in a solid state of matter have a definite shape and a definite volume?
vova2212 [387]
They cannot move freely but they can vibrate
8 0
3 years ago
Read 2 more answers
3. What changes occurs in Amoeba to survive in adverse conditions?​
worty [1.4K]

Answer:

Cyst formation takes place in Amoeba by the process of multiple fission in adverse condition. When there is no availability of food, cyst formation takes place.

Explanation:

First your welcome

Second Give Me Brainless

Third Stay Happy

Fourth Take Care

Fifth Bye

5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the definition of antigen
    8·1 answer
  • Which best statement best describes what a thylakoid does during photosynthesis
    5·2 answers
  • A sodium-potassium pump within a cell membrane requires energy to move sodium and potassium. the movement of glucose does not re
    7·1 answer
  • When comparing the three key models of dna replication, the model that included the synthesis of a brand new double stranded dna
    5·1 answer
  • What causes Down syndrome?
    10·2 answers
  • 37. Each year, over _______ million collisions occur.<br> A. 3<br> B. 5<br> C. 10
    6·1 answer
  • Energy Graph
    14·1 answer
  • The structures of the dermal and vascular systems work together to transport and provide materials essential for photosynthesis.
    5·1 answer
  • 14. The elements in group_
    11·1 answer
  • Which of the following distinguishes the relationship between a taxon and taxonomy?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!