1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
10

A scientist grew bacteria in a petri dish in her lab. she wanted to find out if the bacteria would grow faster in petri dish a o

r petri dish b. after 24 hours, she observed how many bacteria were present in each dish.
what are the independent and dependent variables in this experiment?
Biology
1 answer:
babymother [125]3 years ago
4 0

Answer:

The independent variable is not depending on anything. For this question, the independent variable is bacteria growth. The dependment variable depends on some thing. For this question the dependent variable is different petri dishes.

You might be interested in
Which group of reactions is responsible for the synthesis in photosynthesis?
Blizzard [7]
Calvin cycle is responsible.
3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What are the three main ways that a biome is classified?
OverLord2011 [107]
<span>Biomes are defined as the world's major communities, classified according to the predominant vegetation and characterized by adaptations of organisms to that particular environment.</span>
6 0
3 years ago
Which is a part of the male part of the flower?
zavuch27 [327]

it is not stamen idk the answer but i got stamen wrong

4 0
3 years ago
Read 2 more answers
PLEASE HELP I WILL GOVE BRAINLIEST!! What do mutations cause?
goblinko [34]
Mutations can lead to changes in the structure of an encoded protein or to a decrease or complete loss in its expression. Because a change in the DNA sequence affects all copies of the encoded protein, mutations can be particularly damaging to a cell or organism.
3 0
2 years ago
Read 2 more answers
Other questions:
  • The dietary guidelines for americans promote a minimum of _____ minutes of moderate exercise weekly. 40 80 150 120
    11·2 answers
  • HELP ME PLEASEEEEE I WILL MAKE THEM THE BRAINLIST ANSWER IF YOU ANSWER NOW!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    6·1 answer
  • Competition among members of the same species is called
    14·1 answer
  • In addition to their circular chromosome bacteria also have smaller rings of DNA called
    13·1 answer
  • What most likely caused the rocks in this region to weather
    11·1 answer
  • What is the most common simple method for assessing the risk associated with body type?
    10·2 answers
  • If R is dominant over r what is the chance that an offspring will exhibit the dominant trait
    10·1 answer
  • Why fluids can flow while solids cannot (particle theroy)
    9·2 answers
  • Which type of rock can only form on or very near Earth's surface?
    15·2 answers
  • Infiltration is the process that helps to add water to the Earth's
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!