1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
4 years ago
9

The sumatran rhinoceros is one of the world's rarest mammals. found only in borneo, malaysia, and sumatra, there are estimated t

o be only about 400 rhinos alive. any more habitat loss will probably doom the rhinoceros. without significant resources established, the rhino will remain ________________. however, if nature preserves are set aside for the rhino and the population expands to a few thousand, it will probably be listed as _____________________.
a.extinct, endangered
b.extinct, threatened
c.endangered, threatened
d.threatened, endangered
Biology
2 answers:
marusya05 [52]4 years ago
7 0
The answer is C. The rhino will start off as endangered then listed as threatened,they are no longer endangered with the right resources to help them expand.

<span />
Margarita [4]4 years ago
6 0
Endangered, threatened

You might be interested in
How does a mouse obtain energy for everyday functions? How might this look different compared to how an own obtains energy?
Gemiola [76]

Answer:

A mouse would obtain energy from plants that have vitamins and minerals, and protein from things like nuts. An owl would get protein from eating a mouse and vitamins and minerals from the things the mouse ate.

Explanation:

It's all one big circle. These nutrients would provide the energy needed to perform everyday tasks.

7 0
3 years ago
In addition to being long, threadlike structures found on fungi, what is another characteristic of hyphae? A) They dissolve when
bogdanovich [222]

Answer: C)They usually grow underground in tangles.

Fungi are eukaryotic, saprophytic organisms, that derive their nutrition by decaying the dead organic matter. They exhibit thread like structures called as hyphae, that helps in obtaining food. These hyphae grows underground to locate dead animal and plant matter, decay it and obtain food from it.

6 0
3 years ago
Read 2 more answers
While you are inserting an oropharyngeal airway into a patient's mouth, he begins to gag and then vomit. how should you respond?
den301095 [7]
Hello! If this takes place, then the EMT probably did not use the correct method. They should tilt the head while keeping the chin up. This prevents them from being able to gag. You would not want to change the oxygen flow because that one was probably correct for their situation. So just remove<span> the air supply and follow the head tilt-chin lift procedure.

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy</span>
8 0
3 years ago
The carbon cycle is critical to________<br> as it is part of _____
Dima020 [189]

Answer:

I'll take a look at your question

Explanation:

The Carbon Cycle is important to the life and development of Trees and Plants as a whole.

We breathe in Oxygen that is provided from the Trees that provide that provide it.

We exhale Co2 ((Carbon Dioxide)) for the Trees to breathe in. This entire cycle and process ensures that we survive as a planet.

As it is an essential part of life

3 0
4 years ago
Forensic investigators uncover evidence of what
PtichkaEL [24]

They uncover evidence of crimes, mostly things involving dna like finger prints or blood.

8 0
3 years ago
Other questions:
  • Refer to the following food chain: A fly eats a piece of fruit; a spider eats the fly; a bird eats the spider. The bird dies, an
    5·2 answers
  • During which phase of the cell cycle is chromatin duplicated?
    9·1 answer
  • The following lists are nations with mixed economies. In which list is the free market most dominant?
    13·1 answer
  • Astronauts have been exploring outer space in manned spacecraft since 1961. Which of the following would have made it very dange
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which best describes one way a large body of water such as an ocean influences climate? A. Rushing water from tides cools the la
    11·2 answers
  • List two simple and practical ways in which water can be conserved in the bathroom. In your own words, explain how these strateg
    10·1 answer
  • Which of the following best describes a career in Genetic Technology?
    5·1 answer
  • Which statement describes the iterative step in the engineering design process
    14·1 answer
  • Which of the following terms refers to units of DNA Inherited from parents? А) antibodies B) genes C) reagents D) phenotypes​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!