1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
4 years ago
11

Many geologic processes and events are due to _____.

Biology
2 answers:
GaryK [48]4 years ago
7 0

Answer:

D .plate tectonics

Explanation:

ad-work [718]4 years ago
4 0
Answer : D Plate tectonics
You might be interested in
Pls help giving brainliest !!!!!!!!!!!
soldier1979 [14.2K]

Answer:

Your answer is 2.

Explanation:

To calculate the mechanical advantage of a pulley you simply have to count the number of rope sections that support whatever object you are lifting (not counting the rope that is attached to the effort). For example, in a one pulley system the MA is 1. In a two pulley system the MA is 2.

7 0
3 years ago
Read 2 more answers
If plants are absorbing and using blue and red light, what must be happening to other colours of light, like green and yellow?
Semenov [28]

Answer:

The colours like green and yellow are being reflected.

As we know if the colour is green then it is reflecting green light

Explanation:

8 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A certain species of plant has four unlinked genetic loci, w, x, y, and z. each genetic locus has one dominant allele and one re
Charra [1.4K]
The genotype of the plant is <span>WwXxYyZz.
The plant has a 50% chance of passing each of the alleles of a gene, the dominant or the recessive.
So, for  producing the haploid genotype of a gamete </span><span>Wxyz the chance is
0,5 (W)* 0,5 (x)* 0,5 (y) * 0,5( z)= 0,0625

</span><span>
</span>
3 0
3 years ago
Read 2 more answers
What is the purpose of the pancreas?
arlik [135]

i would say D. ! :) let me know if this is correct

3 0
3 years ago
Other questions:
  • _______ _______ argues that speciation occurs relatively quickly, in rapid bursts, with long periods of genetic equilibrium in b
    8·1 answer
  • The type of rna that carries the instructions for making a protein is called
    9·1 answer
  • Question 9 of 10
    8·2 answers
  • Which of the following applies to human skin color?
    7·2 answers
  • PLS HELP I DONT UNDERSTAND!!! :( WILL MARK BRAINLIEST!!!
    11·1 answer
  • Help please 30 points will give brainliest
    7·2 answers
  • Which of the following terms describes the following:
    5·1 answer
  • How much stronger is an earthquake of magnitude 7, than an earthquake of magnitude 6?
    14·1 answer
  • Question 6 of 10
    7·1 answer
  • A mutation in which one nucleotide in the dna sequence is substituted for another nucleotide is referred to as a ________ mutati
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!