1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
3 years ago
9

Determine if each event most directly affects the geosphere or the biosphere

Biology
2 answers:
lana66690 [7]3 years ago
5 0

<u>Answer</u>:

<em>Biosphere</em> - mold growing on a plant & deforestation

<em>Geosphere </em>- mining of gold, iron and silver & an earthquake leads to the formation of a new mountain

<u>Explanation</u>:

The <em>biosphere</em> is defined as the regions of a planet's surface and atmosphere occupied by living organisms. Both deforestation and mold growth represent events that affect living organisms and thus the biosphere.

The <em>geosphere</em> is a name given to the solid parts of a planet such as the mantle and crust. Both mining and the earthquake affect the outmost solid layer of our planet - the crust. Thus, both of these affect the geosphere.

<em />

Paraphin [41]3 years ago
5 0

Biosphere - mold growing on a plant & deforestation

Geosphere - mining of gold, iron and silver & an earthquake leads to the formation of a new mountain

You might be interested in
According to Darwin's theory of evolution, how do new species evolve?
Vikki [24]

Answer:

According to Darwin's theory of evolution, new species evolved as a result of natural selection.

Explanation:

  • Darwin proposed that speciation could readily occur through the prolonged action of Natural selection.
  • Natural selection allows the 'survival of the fittest' i.e. a more fit organism will have a better chance of survival than the less fit one.
  • The result of Natural selection could be positive,negative or balancing.
  • Evolutionary process in which the genetic changes confer a higher fitness to increase frequency of the organism over time in population is called positive selection.
  • Evolutionary process in which genetic changes decreases the organism's fitness resulting in its disappearance from the population is called Negative selection.
  • It may happen that a mutation benefits hetero-zygotes but not homo-zygotes and alleles maintain a intermediate frequency in population.This evolutionary process is called balancing selection.
8 0
4 years ago
What type of reproduction is shown in the diagram?
Debora [2.8K]

Answer: Budding

Explanation: The organism is as3xually reproducing an offspring that is an exact clone of itself in the form of a bud.

3 0
2 years ago
In which atmospheric layer do humans live most of their lives?
OverLord2011 [107]
Breathing source oxygen elements easy to live human
5 0
3 years ago
"It is best to go skiing in January. It snows most of the month of January" This refers to the area's ______ weather or climate?
exis [7]
#1 is climate, whether is specific climate is over all what it does
#2 It is weather, you don't usually need galoshes only when it rains its climate isnt to rain that particular day, that is its weather
#3 again refers to weather, it isn't always windy just when the weather turns.
6 0
3 years ago
The heart is about the size and shape of your ...
Damm [24]
The answer is Fist hope I helped
3 0
4 years ago
Other questions:
  • Around what week are fetal movements first felt by the mother?
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The blood pressure is regulated partly by ________, which measure blood pressure and are located in the aorta and carotid arteri
    11·1 answer
  • This food web represents a community along the coast of Alaska
    6·2 answers
  • With this concern in mind, you make plans to increase the stringency of the SSOPs, and develop containment plans to minimize cro
    15·1 answer
  • How does the messenger RNA (mRNA) in the vaccine help your body fight coronavirus?
    10·1 answer
  • What is Gametogenisis
    11·1 answer
  • FILL IN THE BLANK PLS HELP I HAVE 20 MINUTES TO SUMBIT THIS!!​
    10·1 answer
  • Cells (biology): What are the steps of cellular respiration?
    15·1 answer
  • In desert areas covered with black rock from ancient lava flows, rock pocket mice with darker fur are common. In other areas of
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!