1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
10

Witch one is it a,b,c or d

Biology
2 answers:
ValentinkaMS [17]3 years ago
8 0

Answer:

b. a higher luminosity

Explanation:

Nina [5.8K]3 years ago
4 0

Answer:b

Explanation: becuase it is a powerful luminosity

You might be interested in
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
Which pair of terms are missing from A and B on the diagram?
Semmy [17]

Answer:

A, chlorophyll; B, ATP is the correct answer.

Explanation:

I took the quiz and got it right.

6 0
4 years ago
Read 2 more answers
A group of scientists is studying the fossils of three different hominids. They find that the DNA of the first hominid is more s
Aleks [24]
That hominids can be very alike but also very unlike.

Hope it helps

6 0
3 years ago
Read 2 more answers
Lana is studying the deer that live in a forest. She concludes that all of the deer are members of the same
yKpoI14uk [10]

Lana concludes that all of the deer in a forest are members of the same (geosphere / ecosystem / species / hydrosphere) because they look alike and breed with one another. She observes how the deer (population / community / ecosystem / biosphere) interacts with trees, wolves, and other living things of the forest (population / community / species / geosphere).

Answer:

1.  Species

2.  population

3.  community

Explanation:

Given the available options. Here is the correct or full text that matches with the correct meanings.

Lana is studying the deer that lives in a forest. She concludes that all of the deer are members of the same SPECIES because they look alike and breed with one another. Next, she observes how the deer POPULATION interacts with trees, wolves, and other living things of the forest COMMUNITY

7 0
3 years ago
What types of materials could be broken dowr in a compost pile? A all recyclable materials B biodegradable materials C all mater
ElenaW [278]

Answer:

All biodegradeable materials.

4 0
3 years ago
Other questions:
  • Levothyroxine, corticosteroids, and warming blankets are often used in the treatment of which medical emergency in the emergency
    15·1 answer
  • Variations in genotypes can be caused by all of the following except?
    13·1 answer
  • Where in the digestive system is food stored, churned, and mixed?
    9·1 answer
  • Shane chose a nonfiction book about styles of dress during the 1920s. It contained factual stories, information, and pictures of
    8·2 answers
  • Lumps of iron and manganese ore called ________ can be harvested from the seafloor near underwater volcanoes.
    6·2 answers
  • What is directly responsible for matter moving and changing inside a bears body?
    7·1 answer
  • 8. Which process is responsible for destroying shorelines along seawalls near urban areas?
    10·2 answers
  • Help me please and thank you ​
    9·1 answer
  • What form of reproduction in these pictures of hydras
    6·1 answer
  • Pathways that support communication among the various electronic components on the system board are called _______.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!