1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
8

missive segment is the axon hillock. The main activity that occurs at the transmissive segment is the release of neurotransmitte

r from ____________ . Prior to the arrival of the action potential, ____________ embedded in the plasma membrane of a synaptic knob establish a ____________ concentration gradient by pumping it out to the IF. Consequently, there is more calcium ____________ of the syn
Biology
1 answer:
Mumz [18]3 years ago
6 0

Explanation:

The main activity that occurs at the transmissive segment is the release of neurotransmitter from synaptic vesicles . Prior to the arrival of the action potential, Ca2+ pumps embedded in the plasma membrane of a synaptic knob establish a calcium concentration gradient by pumping it out to the IF. Consequently, there is more calcium inside of the synaptic knob than outside it.

Further Explanation:

At synaptic junctions:

  • The action potential travels along the membrane until the synapse where it’s electrical depolarization leads to the opening of channels allowing Ca2+ to rush into the terminal due to higher extracellular concentrations
  • these flow through a presynaptic membrane until the concentration is built up, activating ion sensitive proteins attached to vesicles containing neurotransmitters
  • this leads to changes in the proteins leading to the fusion with the membrane of the presynaptic cell, so vesicles are open and neurotransmitter is released. The neurotransmitter diffuses across to chemical receptors on the presynaptic cell where they bind temporarily
  • This leads to activation of specific complexes, enabling the transmission of information. Thus, the chemical signal is transferred through this neuron as an electrical impulse

Learn more about the autonomic nervous system at brainly.com/question/10386413

Learn more about neurotransmitters at brainly.com/question/9424160

Learn more about homeostasis at brainly.com/question/1601808

#LearnWithBrainly

Read more on Brainly.com - brainly.com/question/13844620#readmore

You might be interested in
Q: A: Which of these best describes what occurs during cytokinesis?
Nitella [24]
The correct answer is the cytoplasm is divides between the two new daughter cells Cytokinesis is the final stage of the cell cycle in which cytoplasm, the material within the living cell, divides into two daughter cells.
5 0
3 years ago
In the 1990’s, scientist showed that Archaea and Bacteria are very different groups of organisms. How did the impact the classif
Nataliya [291]
B. The levels of classification increased. Previously there were only 2 domains of life, Bacteria and Eukarya, but an additional domain and Kingdom were added when the distinction of Archaea was observed.
4 0
4 years ago
At which one of the following days in the 28-day cycle is a woman MOST likely to get pregnant?
motikmotik

Answer:

The answer is day 14 - / + 3 days

Explanation:

In a 28-day menstrual cycle the most likely days for a woman to become pregnant is from day 14 - / + 3 days, that is, days 11, 12, 13, 14, 15 and 16. She should be educated, If she is in search of pregnancy, take the vaginal temperature and realize how the viscosity of the abundant flow begins to present.

4 0
3 years ago
Which question can be answered by following the scientific method? What was the highest temperature that was recorded yesterday?
ale4655 [162]
<span>How does a change in temperature affect the stomata of a plant?

This one you could set up an experiment with different temperatures with different plants and see if the stomata change.

A and D are just facts and B is an opinion

Hope that helps</span>
6 0
3 years ago
Read 2 more answers
Identify the mutagenic effects of deaminating agents, alkylating agents, and base analogs.
Mila [183]
<span>All are mutagenic because they cause base substitutions, deaminating agents oxidatively deaminate bases so cytosine converted to uracil and adenine converted to hypoxanthine, uracil pairs with adenine and hypoxanthine pairs with cytosine, alkylating agents donate alkyl group to amino or keto groups altering base pair affinities</span>
7 0
3 years ago
Other questions:
  • Explain what happens during solar eclipse
    6·2 answers
  • Fill in the blank
    11·2 answers
  • The red sizing bead in this image is 10um in diameter. What is the length of a chloroplast? a20um b100um c2um d1um e10um
    6·1 answer
  • What name is given to the monomers of proteins
    12·2 answers
  • Which term describes the entire DNA for an organism? I NEED HELP ASAP PLEASE HELP!!!!
    9·2 answers
  • Explain what processes are going on in the picture? What do the numbers 1 and 2 mean?​
    6·1 answer
  • Bacterial infections are caused by _____.
    11·1 answer
  • Darwin suggested that plants pollinated by long tongued insects would benefit by having long flowers. To measure the advantaged
    14·1 answer
  • Which statement describes the relationship between the deer and plants on the food web? (3 points) Tree is consumed by insect, w
    5·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!