1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
4 years ago
9

A neuron either fires or it doesn't, and once an action potential has been initiated the impulse travels the entire length of th

e axon without further need of stimulation. This describes the:
Biology
1 answer:
Katen [24]4 years ago
6 0
Signals are transmitted from neuron to neuron via an action potential, when the axon membrane rapidly depolarizes and repolarizes.
You might be interested in
Factors that control populations that come from outside the population are known as
gladu [14]
Limiting factors

for example: amount of food, water, shelter, predators, etc
3 0
3 years ago
Read 2 more answers
Match the organelle to its function-
daser333 [38]

Answer:

I seriously do not understand, you clearly know the answers.  You put all of the correct matchings on your assignment.  Are you trying to give free points?  I am literally so confuse.  Thank you for the free points, and hope you have a bless day.

Explanation:

7 0
3 years ago
Do oxygen atoms become more stable or less stable when oxygen forms compounds. Explain.
Anit [1.1K]

Answer:

Do oxygen atoms become more stable or less stable when oxygen forms compounds? They become more stable because they gain or share valence electrons giving each oxygen atom a set of 8 valence electrons. They change because the number of valence electrons changes in a pattern that repeats in each period.

8 0
3 years ago
Cross two pea plants. Both are heterozygous for seed type; round (R) is dominant to wrinkled (r).
Fudgin [204]

Answer: I hope the file helps you out :)

Download pdf
5 0
3 years ago
There are two rainforest biomes, a temperate and a tropical. What makes them so different? PLS HELP ME!!!
Ivan

Answer: Tropical rain forests experiences no seasons because it is just hot all year round while temperate rain forests experiences four seasons. Tropics also receive the most sunlight in the planet while temperate rain forests receive light at a slanted angle.

6 0
4 years ago
Other questions:
  • Arrange the processes of the water cycle in the correct order, starting with the heat from the sun
    10·2 answers
  • Wich is the cell structure that is made of DNA that gives the master instructions for the cell?
    10·1 answer
  • Mitotic cell division is initiated in the ?
    11·1 answer
  • Cells get energy from food and remove waste to substain the life of the organism. This statement supports what part of the cell
    9·1 answer
  • In an experiment,the group that is exposed to the variable to be tested is called
    8·1 answer
  • Why is fiber necessary in a persons diet?
    14·1 answer
  • What is farming method that reduces the steepness and lengths of a slope.
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The lactobacilli, in their role as normal flora of the vagina, help the vagina resist infection by contributing to A. the neutra
    7·1 answer
  • In your mouth, teeth grind food <br><br> a. mechanical <br> b.chemical
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!