1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
11

Please help

Biology
2 answers:
Semenov [28]3 years ago
7 0

Answer:

In an experiment, there should be ONE independent variable(s) and ONE dependent variable(s). At least

Explanation:

You are doing chores to earn your allowance. For each chore you do, you earn $3

What is the dependent variable?

The dependent variable is the amount of money you earn because the amount of money you earn depends on how many chores you do.

kobusy [5.1K]3 years ago
6 0

I believe the answer is C. I could be wrong and it may be B

You might be interested in
List and describe the factors which affect the speed of a chemical reaction
skelet666 [1.2K]
Factors that influence the reaction rates of chemical reactions include the concentration of reactants, temperature, the physical state of reactants and their dispersion, the solvent, and the presence of a catalyst.

Source: Google
6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
A polypeptide in a wild type microbe contains the sequence Leu-Pro-Tyr-Ser-Pro. A phenotypic variant of the species has the pept
Katen [24]

Answer:

The mentioned case is an illustration of the missense mutation. A missense mutation is a kind of nonsynonymous substitution, that is, it is a mutation in which a variation in a solitary nucleotide leads to the formation of a codon, which encrypts for a distinct kind of amino acid.  

When a missense mutation takes place within a DNA, a modification in one of the RNA codon sequences results at the time of transcription. This change in codon will ultimately result in the formation of a different amino acid, which gets presented within a protein at the time of translation. Like in the given case, a change in codon resulted in the substitution of the amino acid tyrosine with an amino acid cysteine.  

8 0
3 years ago
Blood flow in the capillaries is
yaroslaw [1]

Answer:

A

Explanation:

Blow flow in the capillaries is slowest despite the large surface area. This is to allow for exchange of gases and nutrients at the cellular level.

3 0
3 years ago
Read 2 more answers
Which material has the highest thermal conductivity? Which material has the highest electrical conductivity? Explain why thermal
olga55 [171]

Answer:Silver

Explanation:Silver has the highest electrical conductivity of all metals. In fact, silver defines conductivity - all other metals are compared against it. On a scale of 0 to 100, silver ranks 100, with copper at 97 and gold at 76.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Staphylothermus marinus is an extremophile archaean that inhabits deep oceanic hydrothermal vents at temperatures near boiling.
    7·1 answer
  • Which structures add to the fluidity of the plasma membrane:
    9·1 answer
  • Why do the cells in all living things need energy?
    11·2 answers
  • Meiosis and mitosis are both forms of cell division. However, the outcomes of these processes differ. Consider a diploid organis
    10·1 answer
  • What other molecules in a patient’s blood are monitored along with ldl and hdl?
    14·1 answer
  • What Are Some Reasons that explain why viruses evolve so fast
    14·1 answer
  • Multiple Choice Question Which of the following does NOT occur during interphase as the cell gets ready for mitosis? A. The cent
    14·1 answer
  • Which statement is most accurate regarding the effect of decomposition on soil?
    14·2 answers
  • Assume a physiologist has inserted a microelectrode into a neuron when it is at rest. The voltage recorded at the arrow tip will
    12·1 answer
  • QUESTION:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!