1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
10

Which best describes food when it reaches the stomach?

Biology
1 answer:
katrin2010 [14]3 years ago
4 0

Explanation:

The polysaccharides have been broken down.

You might be interested in
Which nucleic acid serves as a strand for protein synthesis?
sattari [20]

Answer:

c.mRNA...............

5 0
3 years ago
Neurotransmitters are ________. Group of answer choices chemicals that cross the synaptic gap and bind to receptors on another n
Hoochie [10]

Answer:

chemicals that cross the synaptic gap and bind to receptors on another neuron

found only in the central nervous system (the brain and spinal cord)

Explanation:

Neurotransmitters are defined as the chemicals that is transported from a nerve cell across the synaptic gap to the receptor of another neuron or a target cell such as a gland cell or a muscle cell.

Neurotransmitters are generated in the central nervous system (the brain and spinal cord) and are stored in synaptic vesicles.

"Hence, the correct answer is:

chemicals that cross the synaptic gap and bind to receptors on another neuron

found only in the central nervous system (the brain and spinal cord)".

8 0
3 years ago
The outer boundary of most cells is called​
Gre4nikov [31]

Answer:

Cell membrane

Explanation:

The cell membrane is a flexible and permeable skin surrounding a cell.

8 0
3 years ago
How does water enter the atmosphere? a. liquid water evaporates from lakes when heated by the sun. b. frozen water sublimates fr
pentagon [3]

Answer:

<u>d</u>

Explanation:

Water enters the atmosphere by :

⇒ liquid water evaporates from lakes when heated by the Sun

⇒ frozen water sublimates from ice and snow

⇒ liquid water is lost from tree leaves during evapotranspiration

7 0
2 years ago
Plants exchange gas with the atmosphere. Which statement accurately describes this process?
larisa86 [58]

Answer:

C. Plants release carbon dioxide and take in oxygen through the xylem in leaves.

Explanation:

Plants exchange gas with the atmosphere and release carbon dioxide and take in oxygen through the xylem in leaves.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Bacteria are the simplest single cells that ____.
    5·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which part of the nucleotide stores the genetic information?
    15·1 answer
  • Why do scientists use taxonomy to classify organism
    6·1 answer
  • What are functions of protein
    7·2 answers
  • What process takes place in chloroplasts?
    5·2 answers
  • Which automatic system conserves energy by returning the body to a normal activity level through a lowered heart rate and blood
    5·1 answer
  • Write the name of each technique in the blank beside its description A. ___________________________ produces a record of electri
    9·1 answer
  • How does the destruction of T cells interfere with the body’s ability to fight disease?
    6·1 answer
  • Which statement best explains an environmental outcome of using fossil fuels for energy? (1 point)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!