1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
14

Which statements describe the movement of blood through the heart? Select two options.

Biology
2 answers:
Katarina [22]3 years ago
8 0

Answer:

first sentence and last sentence

attashe74 [19]3 years ago
8 0

Answer:

the anwser is Ventricles push blood out of the heart.

Explanation:

Ventricles push blood out of the heart. The right atrium receives oxygen-poor blood from the body and pumps it to the right ventricle through the tricuspid valve. The right ventricle pumps the oxygen-poor blood to the lungs through the pneumonic valve.

You might be interested in
What is the RNA complementary strand for GAACAT?
Inessa05 [86]

The RNA complementary strand would be CUUGUA

6 0
3 years ago
Give the role of air in an ecosystem
Radda [10]

Sustain Life and Growth

Air consists one of the main life-sustaining gas called oxygen. Almost all living things breathe in and breathe out this air. Nitrogen and Carbon dioxide are also other gases that are vital for plants and their growth.

Combustion

Apart from this, air supports burning or combustion. The oxygen present in air help in burning of the fuels to basically carry out activities like cooking food, running industries and vehicles as well as generating heat and electricity.

Temperature Control

Another important aspect of air is that it helps in maintaining the temperature on the earth surface by circulating hot and cold air. Air acts as a conductor of heat as well. Even phenomena such as water cycle are dependent on air.

Supplier of Energy

Air which consists of energy is one of the main suppliers of energy. Living things are made up of cells and these cells extract oxygen within the blood to produce energy usually in the form of ATP. This biochemical generation of ATP is essential to maintain life on the earth.

Photosynthesis

Carbon dioxide, which is a component of air is used by plants during the process of photosynthesis. Here oxygen is also released by plants. And we already know how vital oxygen is.

3 0
2 years ago
Read 2 more answers
A nurse is caring for a client who has cancer. the clien has decided to stop treatment and requests a refferal to hospice
Dominik [7]
The nurse has to do as the client requested. This is because they have to observe the autonomy aspect of the ethical standard which states that the client's must be respected. Autonomy gives the patient power to make his or her own decisions concerning health care.
8 0
3 years ago
Which of these choices is an advantage of the Endangered Species Act?
Sindrei [870]

The correct answer is option C, that is, saves species from extinction.  

The Endangered Species Act is one of the most essential and efficient environmental laws of America. It signifies a willingness by the people of America to work in harmony and restore and protect the species most vulnerable of getting disappeared forever.  

The act offers common sense, balanced solutions for the landowners, government agencies, and concerned citizens to preserve the endangered wildlife and their habitats. It includes three prime elements:  

1. Inhibiting the listed species from getting harmed or killed

2. Developing plans to restore healthy populations

3. Safeguarding habitat important to these species survival.  


3 0
3 years ago
Read 2 more answers
Organisms differ from one another and yet share common characteristics select two kingdoms and briefly describe
Inga [223]
Take for example the group of prokaryotes against eukaryotes. They may be similar in a way that they contain cells with organelles such as mitochondria, ribosomes, cytoplasm, and many more. But they may differ in the presence of a cell membrane and a nucleus. Eukaryotes have cell walls and a nucleus, while prokaryotes don't have.
6 0
3 years ago
Other questions:
  • Levels of biological organization from most complex to least complex?
    12·1 answer
  • Which of the following statements is true?
    12·2 answers
  • Respiration involves the release of energy due to the breakdown of large polymers. What type of a reaction is respiration?
    14·1 answer
  • The type of learning that occurs when a stimulus produces a particular response because it is associated with a positive or nega
    10·1 answer
  • Identify the placement of items A-F using the drop-
    9·2 answers
  • Which organ is responsible for manufacturing and secreting digestive enzymes and bicarbonate?
    9·1 answer
  • Pead this passage
    6·2 answers
  • At the very beginning of translation, the first tRNA molecule __________. Attaches directly to the DNA codon connects an amino a
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Where are chromosomes located during metaphase?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!