1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
9

Accessing a website in search of magazine articles about a product before its purchase is an example of the ________ stage of th

e consumer-buying model.
post-purchase evaluation

information seeking

evaluation of alternatives

need recognition
Law
1 answer:
Dima020 [189]3 years ago
5 0

Answer:

information seeking

Explanation:

You might be interested in
Mutual funds require a minimum investment<br><br> True or false
Stells [14]

Answer:

Although there <em>are</em> mutual funds with no minimums, most retail mutual funds do require a minimum initial investment of between $500 to $5,000

3 0
3 years ago
Read 2 more answers
How do you draft a bill
beks73 [17]
A draft is any piece of written legislation, at whatever stage of preparation, that has not yet been introduced as a bill or offered as an amendment. ENGROSS. Engross means to incorporate the amendments and corrections into the text of the bill after a committee or either house has adopted it.
8 0
3 years ago
100 POINTS FOR ANSWERING THIS<br><br> What are your thoughts on the whole Afghanistan incident?
Alexxandr [17]

Answer:

tbh it sucks. whats the point in hurting others because there not like you?

Explanation:

6 0
3 years ago
Read 2 more answers
7. Activities that give rise to _____ are maintaining a dangerous animal, engaging in an abnormally dangerous activity, and manu
UkoKoshka [18]

Activities that give rise to <u> strict liability  </u>are maintaining a dangerous animal, engaging in an abnormally dangerous activity, and manufacturing or distributing a defective product

Explanation:

Strict liability can be defined as the doctrine that makes a person liable even if the person did not act with fault or negligence

<u>This Liability imposes legal responsibility for injuries and damages even if the defendant   who was found liable is without fault</u>

<u></u>

Activities that give rise to <u> strict liability  </u>are maintaining a dangerous animal, engaging in an abnormally dangerous activity, and manufacturing or distributing a defective product.

<u>Selling Alcohol to a minor,having sex with a minor are few example of Strict Liability</u>

6 0
3 years ago
Which of these is the best reason to explain why candidates for office hire campaign staff to run their campaigns?
prisoha [69]

Answer:

Campaigns are complex undertakings, and candidates must hire staff members to manage specific activities

If candidates for office lose their runs for office, they can blame staff members for what went wrong

this is your answer

3 0
2 years ago
Other questions:
  • You are planning a hunt that will involve
    6·1 answer
  • What can the government do to reduce juvenile delinquency?​
    15·1 answer
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • Recently because of the coronavirus, many prisoners are being released. In your own words, discuss this controversial issue. Sho
    5·1 answer
  • Which term refers to the legitimate writings that a handwriting expert compares to a suspected forgery?
    13·1 answer
  • I want some information about to go to canada please !
    5·1 answer
  • 2. Do you think imprisonment is the only way to rehabilitate a person who violated a law? Why or why not
    14·1 answer
  • PLEASE HELP ASAP!
    5·2 answers
  • You are a supervisor pondering a possible ethical issue. Which word indicates you are approaching motivational blindness?
    12·1 answer
  • All of the Special Agent Entry Programs of the FBI require that an applicant have at least
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!