There heart began to beat faster and their body produce more sweat and there blood is following faet
Opponents of GMOs have been unceasing in their campaign to vilify genetically modified foods by describing them as “Frankenfoods,” thus implying they are not natural and are potentially harmful.
“The practice of introducing new DNA and chemicals to seeds or animals (Aqua Advantage has developed a GMO fish) is similar to how Mary Shelly’s Frankenstein created his monster–—through piecing together lots of different organisms,” wrote the Organic Authority on its website—a common allusion in the anti-GMO world. “We all know what happened when the monster turned on Frankenstein, and many critics of genetic engineering have likened the inevitable backlash of GMO technology to the destruction and murderous rampage of Frankenstein’s monster.”
Many anti-GMO articles that warn of the dangers GM crops are often accompanied by an image of a tomato fruit or vegetable with syringes sticking out of them. Very often it is a fruit or vegetable for which there is no current GM equivalent such as a tomato. This depiction is used to reinforce the notion that GM foods are created in laboratories and not by nature and therefore are dangerous to consume.
With the constant barrage of scare-based imagery, it is not surprising that there is widespread public suspicion that GMOs are dangerous to human health. But there is little controversy surrounding GMOs within the scientific community with 88 percent of the members of the American Association for the Advancement of Science believing GMOs are “generally safe.” The safety of GMOs were once again reinforced by the May 2016 report by the U.S. National Academy of Sciences, Engineering and Medicine, which concluded, there was “reasonable evidence that animals were not harmed by eating food derived from genetically engineered crops”, and epidemiological data indicated there was no increase in cancer or other health related problems associated with these crops entering our food supply.
David Zilberman, a professor of agriculture and resource economics at the University of California, Berkley, has noted that Frankenfood was “a terrible word, a stigmatization word, one that’s used to scare people… People are afraid of GMOs for little or no reason. GM is simply a tool. Because it allows us to modify plants with far greater precision and control then before, it will be very valuable.”
The reality is that the vast bulk of the foods we consume whether organic or conventionally grown have had their genetics altered in the field or in a laboratory via a process of selective breeding or advanced biotechnology techniques, and all such foods are safe to eat. The altering of genes in plants is even known to occur naturally as highlighted by the sweet potato.
The physical and the behavioral adaptions of the Black tail helped survive the chaparral biome because the ears for heat dissipation to keep cool.
~Jurgen
Blood is considered<span> a </span>connective tissue<span> for two basic reasons: ( 1 ) embryologically, it has the same origin ( mesodermal ) as do the other </span>connective tissue types<span> and ( 2 )</span>blood<span> connects the body systems together bringing the needed oxygen, nutrients, hormones and other signaling molecules, and removing the wastes .</span>
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
