1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
9

How many moles of O2 gas will be produced at STP from 4 moles of KC1O3

Chemistry
1 answer:
sveticcg [70]3 years ago
6 0

Answer:

6moles of O2 will be produced

Explanation:

Step 1: write the correct and balance the equation

2KClO3 --------> 2KCl + 3O2

Step 2: find the mole

2 moles of KClO3 gives 3moles of O2

We are provided with 4 moles of KClO3,

Since 2 moles of KClO3 = 3 moles of O2

4 moles of KClO3 = x moles of O2

Cross multiply

2 = 3

4 = x

4 * 3 = 2 * x

12 = 2x

Divide both sides by 2 , to get the mole of O2

12/2 = 2x/ 2

6 = x

x = 6

The mole of O2 is 6 moles

You might be interested in
PLEASE HELPPPP what characteristics of the bond you choose are persent in H2O.​
Andrej [43]
Water molecules forming hydrogen bonds with one another. The partial negative charge on the O of one molecule can form a hydrogen bond with the partial positive charge on the hydrogens of other molecules. Water molecules are also attracted to other polar molecules and to ions.
6 0
2 years ago
According the the arrhenius theory, which species does an acid produce in an aqueous solution?
4vir4ik [10]
Note: Above question is incomplete: Complete question is read as 
<span>According the the arrhenius theory, which species does an acid produce in an aqueous solution?
</span>A) hydrogen ions B) hydroxyl ions C) Sodium ions D) Chloride ion
.....................................................................................................................
Correct answer for above question is A) Hydrogen ions

Reason:
According the Arrhenius theory of acid and base, acid generates hydrogen ions in aqueous medium, while bases generates hydroxyl ions in aqueous medium.  
Example of Acid:
HCl(aq)          →          H+(aq)    + Cl-(aq)

Example of Base:
NaOH(aq)           →          Na+(aq)       +     OH-(aq)


6 0
2 years ago
Looters break a statue into pieces. How do you expect the weathering of pieces of rock to change?
andreyandreev [35.5K]
The statue will weather faster because of more surface area.
5 0
3 years ago
In general, in what type of solvent (non-polar, moderately polar, or highly polar) are polar solutes most soluble? Explain why.
tia_tia [17]

Answer:

  • In general, polar solutes are most soluble in highly polar solvents.

Explanation:

The general rule is "like dissolves like" which means that <em>polar solvents </em>dissolve polar (or ionic) <em>solutes</em> and <em>non-polar solvents</em> dissolve non-polar solutes.

In order for a solvent dissolve a solute, the strength of the interacttion (force) between the solute and the solvent units (atoms, molecules, or ions) must be stronger than the strength of the forces that keep together he particles of the pure substances (known as intermolecular forces).

Since the nature of the interactions between the units are electrostatic, the more polar is the solvent the better it will be able to attract and surround the solute particles, keeping them separated and in solution. That mechanism explains why polar solutes will be most soluble in highly polar solvents.

5 0
2 years ago
Is water a compound?
MariettaO [177]

Answer:

Yes, actually it is a compound.

Explanation:

There are important differences between the properties of a mixture and a compound. In this table, the column Mixture refers to the gasses hydrogen and oxygen, and the column named Compound refers to water.

3 0
2 years ago
Read 2 more answers
Other questions:
  • You are cooking beans over a campfire. By the light of the fire, you read that one serving of beans is 120 calories. After eatin
    5·1 answer
  • During a lab activity, students prepared two solutions separately at the same temperature. Later they mixed the solutions and th
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Is the color In each pen the result of single dye or multiple dyes
    11·1 answer
  • Which atom has a mass of 12 u
    7·2 answers
  • Methane<br><br> state at 25 degrees Celsius​
    9·1 answer
  • Rutherford's alpha particle scattering experiment was responsible for the discovery of​
    15·1 answer
  • Energy of an electron is not constant which it is in particular orbit ( true or false )​
    14·1 answer
  • Any liquid or material that is likely to catch fire should be kept away from a
    11·1 answer
  • 30 treadmills to 36 elliptical machines
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!