1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
15

True or False.

Biology
2 answers:
Sonbull [250]3 years ago
4 0
1 is true and 2 is false
PilotLPTM [1.2K]3 years ago
3 0

Answer:

1) True

2) False

Explanation:

You might be interested in
Can same enzyme have different kinetics for different substrates? What is the biological significance that?
ad-work [718]

An enzyme possesses different kinetics for different substrates as a result of this different products are formed.

Discussion:

  • Multi-substrate reactions are governed by intricate rate equations that specify how and in what order the substrates bind. If substrate B is altered while the amount of substrate A remains constant, the study of these reactions becomes considerably easier. The enzyme behaves exactly like a single-substrate enzyme in these circumstances, and a plot of v by [S] yields the actual KM and Vmax constants for substrate B.
  • These results can be utilized to determine the reaction's mechanism if a series of such measurements are carried out at various fixed concentrations of A. There are two different sorts of mechanisms for an enzyme that accepts two substrates, A and B, and converts them into two products, P and Q: ternary complex and ping-pong.

Learn more about enzymes here:

brainly.com/question/14953274

#SPJ4

3 0
1 year ago
A molecule of a complex carbohydrate is made of 12 carbon atoms. Calculate the numbers of hydrogen and oxygen atoms in the molec
kykrilka [37]
The answer would be 12 oxygen and 24 hydrogen
since the basic formula of carbohydrates is C6H12O6
6 0
3 years ago
The steps of the DNA ladder are made of _____.
stepan [7]
C paired nitrogen bases. hope i help don't forget to go subscribe to king kevin on youtube its my channel i have 840 subscribers plz go subscribe and be active thank you.
5 0
3 years ago
How does pre existing genetic factors and environmental factors both affect your chances to get cancer
yulyashka [42]

Answer:

cancer results not from a single flawed gene, but rather the interplay of multiple genes and any accumulated damage to DNA caused by environmental factors such as exposure to chemicals, or aspects of lifestyle, such as smoking

6 0
2 years ago
Read 2 more answers
Pollution in the environment affects living things
jekas [21]
True. 100% true. Pollution is bad, and living things - even humans - can be effected in it in a negative way, so it's true
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the ratio of surface area to volume for a sphere with the following
    10·1 answer
  • Why do the cells in all living things need energy
    9·2 answers
  • If you are unable to see the road ahead while driving through heavy rain or fog, and your wipers do not help, you should:
    7·1 answer
  • In this exercise, you will identify when various events occur during the cell cycle. recall that interphase consists of the g1,
    13·1 answer
  • Examine the diagram of the food web described in the passage. Using arrows, how would you label the direction of energy flow thr
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Water droplets are pulled towards earth by ______________.
    5·1 answer
  • HELP MEEEEEEE
    12·1 answer
  • What are the light gray lines in the graph showing? Provide examples.
    6·1 answer
  • Erythrocytes live for a maximum of.......days whereas platelets live for ....... days
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!