<span>GPS can precisely measure both horizontal and vertical motions. GPS and other instruments used to measure deformation may detect motion at a volcano before any earthquakes occur, and these changes in shape may accelerate immediately before an eruption, making GPS a valuable monitoring tool.</span>
The answer to this question would be: <span>producing large quantities of proteins for secretion
Cell with many smooth endoplasmic reticulum has a high protein synthesis capability. This will make the cell able to produce many proteins like enzyme. One example of this type of cell will be hepatocyte or cell in the liver. This cell will need many enzymes to detoxify toxin in the body.</span>
Answer:
Adaptive immune defense system consists of lymphocytes like B-lymphocytes and T- lymphocytes. B-lymphocytes provides humoral immunity while T- lymphocytes provide cell-mediated immunity to the body.
99% of lymphocytes circulate freely in the blood and lymph. B lymphocytes differentiate into plasma B cells and B memory cells when interact with antigen presented by T helper cells.
Then plasma cells secrete antibodies in the circulation which binds to extracellular antigens through antigen-binding site. Then the bounded antigen is recognized by receptors present on phagocytic cells. This receptor binds the Fc region of antigen bounded antibody and destroy the antigen by phagocytosis.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
<em>Slay:</em><em> </em><em>To </em><em>kill</em><em> </em><em>(</em><em>a </em><em>person</em><em> </em><em>or</em><em> </em><em>animal)</em><em> </em><em>in </em><em>a</em><em> </em><em>violent</em><em> </em><em>way.</em><em>.</em><em>.</em>
